Művelődés-, Tudomány- és Orvostörténeti Folyóirat
2017/14           ISSN: 2062-2597
Cím: Egy Escherichia coli járvány és a baktérium pathoadaptációjának története

Title: History of an Escherichiacoli epidemic andbacterial patho adaptation
[Letöltés]
Szerző(k): Cseh Károly, Prof. Dr. - Semmelweis Egyetem, Népegészségtani Intézet Kaszás Edit, Dr.
Rovat: A modern orvostudomány története napjainkig
Kötet: 2012/5
DOI: 10.17107/KH.2012.5.86-248
Kulcsszavak:
Escherichia coli, járvány története, pathoadaptáció, tipizálás
Keywords:
Escherichia coli, history of epidemic, patho adaptation typing
Abstract:

In that review we summarize the genetics, pathomechanisms and virulence factors of the different pathogenic E. coli strains. Adhesion structures, adherence, invasion and resistance mechanisms, iron uptake and secretion systems, pathogenicity islands and toxins of the E. coli pathovariants are delineated focusing on the recent advances in that field.  We characterize the specific features of the O104:H4 E. coli outbrake in 2011 in Germany


Szerzőtársak:  Semmelweis Egyetem Népegészségtani Intézet munkatársai: Dr. Alliquander A., Dr. Balázs P.,Dr. Barczi Sz., Dr.Besenyei G., Dr. Csépe P., Dr. Dákay M., Dr. Forrai J., Dr. Horváth F., Dr. Jakabfi P.,Dr.Janik L., Dr. Koncz J., Dr. Leffelholcz E., Dr. Lelkes M., Dr. Makara P., Dr. Pellet S.r, Dr.Pénzes M., Dr. Sima Á., Dr. Somosi Gy., Dr. Terebessy A., Dr. Tompa A., Dr. Pongor V.

Összefoglaló a németországi Shiga-szerű toxint termelő EAEC járvány kapcsán az E. coli baktériumok pathogén szerepéről (DAEC, EAEC, EPEC, EHEC, ETEC, EIEC, NMEC, UPEC) és pathomechanizmusairól

Tartalom
Összefoglalás/Summary

Az E. coli baktériumok okozta fertőzések egészségügyi jelentősége
A 2011 évi Németországban kitört hasmenés járványról röviden
A Franciaországban megfigyelt betegség cluster
ECDC állásfoglalások
Az E. coli baktérium törzsek megismerése
Az NCBI E. coli adatbázis, az ismertebb törzsek adatai
Egyéb adatbázisok
Az pathogén E. coli törzsek által okozott kórképek
A pathogén E. coli törzsek pathomechanizmusa
DAEC
EAEC
EHEC
EPEC
EIEC
ETEC
NMEC
UPEC
A pathogén E. coli törzsek virulencia aktorai
Adhéziós struktúrák, adherencia tényezők adhéziós mechanizmusok
Invazivitás
Vasfelvételi rendszerek
Rezisztencia mechanizmusok, acidikus rezisztencia, tellurit rezisztencia
Bakteriális szekréciós rendszerek, szekretált fehérjék
T1SS
T2SS
T3SS
T4SS
T5SS autotranszporterek, SPATE-k
T6SS
T7SS
Pathogenicitási szigetek
Toxinok
Shiga toxin szerkezete, receptorai, retrográd transzportja, hatásmechanizmusa
Shiga toxint termelő törzsek epidemiológiai adatai
E. colitörzsek tipizálási, szubtipizálási módszerei
A németországi O104:H4 járvány

Az Escherichia coli felelős az USA-ban a kórházi gyógykezelést igénylő klinikai fertőzések 17.3 %-ért. Ebben a tekintetben a második leggyakoribb kórokozó a Staphylococcus aureus után (18,8 %-os előfordulás). Az ambuláns kezelést igénylő fertőzések kórokozói között pedig a leggyakoribb (38,6 %-os előfordulás). Az utóbbi évtizedek során új patogén E. coli törzsek megjelenését figyelték meg. Ezek közé tartozik a hasmenést és hemolitikus urémiás szindrómát (HUS) okozó O157:H7 törzs. Emelkedett a húgyúti pathogenitású E. coli törzsek okozta fertőzések száma is. Az USA-ban az E. coli okozta húgyuti fertőzésekben évente mintegy 7200 személy hal meg. Az E. coli bakteriémiával járó fertőzések során pedig évente 36 000 - 40 000 haláleset fordul elő. Világszerte évről-évre mintegy 1 millió egyén, leginkább gyermekek és immunkompromittált betegek halálát okozza hasmenéssel járó E. coli fertőzés.

Másrészről a legtöbb bélrendszerből izolált E. coli törzs ártalmatlan, kommenzális bélflóra lakó, egészséges egyének és állatok  bélflórájának tagja. Az ubiquiter, bélflórában jelenlévő E. coli törzsek azonban hatalmas rezervoirt képeznek, amelyekből folyamatosan új pathogén törzsek jönnek létre. Ezt a folyamatot az E. coli törzsek két tulajdonsága okozza. Emberhez adaptálódott humán, kommenzális bélflóra lakóként jelen vannak a humán populációban, valamint az állatvilágban. Emellet természetes jellemzőjük genetikus állományuk kicserélődő képessége is, amelynek következtében genetikus diverzitásuk nagyfokú. A rezervoir kollektív genomjának pathogén tulajdonságokat közvetitő génjeit felvéve alakulnak ki az újabb kórokozó baktérium törzsek.

A németországi E. coli járvány a kezdeti klinikai tünetek alapján EHEC (enterohemorrhagiás E. coli) járványnak tűnt. A kórokozó azonban nem egy típusos EHEC szerovariáns (pl. az O157:H7) volt, hanem egy korábban ritkán, egy-egy alkalommal betegséget előidéző kórokozó, az E. coli O104:H4 szerotípusa.

A molekuláris vizsgálatok, a baktérium kromoszóma és a törzs három plazmidjának szekvencia analízise feltárta, hogy egy stx2 gént (stx2a) akvirált EAEC (enteroaggregatív E. coli) törzsről van szó, amely plazmidon kódolt ESBL (extended spectrum beta lactamase, kiterjedt spektrumú béta laktamáz) típusú rezisztencia mechanzimusokat (CTX-M 15, TEM 1), ritka aggregatív adherencia fimbria géneket (aggregative adherence fimbria type 1, AAF/I), valamint három SPATE-t (serin protease autotransporter, SepA, SigA és Pic) is tartalmaz.

A járvány típusos globalizációs sajátosságokat is mutatott. HUS (hemolitikus urémiás szindróma) esetek Európa több országában is előfordultak, a németországi esetek mellett Ausztriában (HUS 1, nem HUS 4), Csehországban (nem HUS 1), Dániában (HUS 9, nem HUS 14), Franciaországban (HUS 8, nem HUS 10), Görögországban (nem HUS 1), Luxemburgban (HUS 1, nem HUS 1), Hollandiában (HUS 4, nem HUS 7), Norvégiában (nem HUS 1), Lengyelországban (HUS 2, nem HUS1), Spanyolországban (HUS1, nem HUS1), Svédországban (HUS 18, 1 halálesettel, nem HUS 35), az Egyesült Királyságban (HUS 3, nem HUS 3), Svájcban (nem HUS 3), Kanadában (nem HUS 1), az Egyesült Államokban (nem HUS 5), a 2011. június 29-i adatok szerint, az előzetesen a járványos területen, Németországban járt személyek között (ECDC Directors’ presentation. Understanding the 2011 EHEC/STEC outbreak in Germany. ICAAC Conference, 17 September 2011, Chicago, USA).

Franciországban június 3-án az Institute de Veille Sanitarie 10 esetet jelentett, korábban Németországból hazatért személyek között.

Június 24-én ugyanez az intézet az aquitaniai régióból további 10 (közülük 8 HUS) esetet jelentett, amelyek közül 7 Bégles város környékén történt, függetlenül a németországi esetektől. 8 HUS esetet kezeltek két Bordeaux-i kórházban. A hírügynökségek jelentése szerint a Bégles környéki esetek közül hatan június 8-án egy biocsíra fesztiválon vettek rész.

Látszólag a németországi járványtól független clusterről volt szó (EFSA/ECDC JOINT RAPID RISK ASSESSMENT. Cluster of haemolytic uremic syndrome (HUS) in Bordeaux, France, 29 June 2011. Updated from 24 June).

A németországi járvány közvetítőjeként több növényi termék vetődött fel, eleinte uborka, babcsíra, lóherecsíra.

Bizonyossággal azonban sem a rezervoirt, sem a rezervoirból való kikerülési utat, sem a közvetítőt nem sikerült azonosítani. Biztos adatokkal csak az epidemiológiai lánc két tagjáról, a kórokozóról és a megbetegedettekről rendelkezünk.

Az European Centre for Disease Prevention and Control (ECDC) több jelentést is kiadott a németországi E. coli STEC járvánnyal kapcsolatban (ECDC Rapid Risk Assesment Outbreak of Shiga toxin producing E. coli (STEC) in Germany Update 14, June 2011.).

Ebben hangsúlyozták, hogy  megelőzően 250 O szerotípusú E coli törzs esetében detektáltak shiga toxin termelést és 100 feletti volt az emberi betegséget okozó szerotípusok száma. Korábban klinikailag az O157:H7 törzseket tartották a legfontosabb kórokozónak, de a STEC fertőzések közel 50%-át nem O157 szerotípusok okozták. Leírták, hogy a STEC fertőzés acut gastroenteritis tüneteivel jelentkezik, gyakran társul enyhe lázzal, néha hányással. A hasmenés a legtöbb esetben enyhe és magától megszűnik, a betegek legtöbbször 1-2 napon belűl meggyógyulnak. A STEC O157 törzzsel fertőződött gyerekek mintegy 15%-ában fejlődik ki súlyos szövődményként HUS. Ez az arány a felnőttek esetében sokkal kisebb. A HUS súlyos, gyakran halálos kimenetelű kórállapot, komplett klinikai tünetcsoportja akut veseelégtelenség, hemolitikus anémia és thrombocytopénia klinikai következményeiből tevődik össze. A HUS kialakulását általában hasmenés előzi meg, amely gyakran véres (Tarr PI, Gordon CA, Chandler WL.Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 2005; 365: 1073–86).

A STEC hasmenés súlyosságát több tényező határozza meg, közöttük az E. coli szerotípus (a szerzők megjegyzése: valójában a patogenicitási faktorok jelenléte a meghatározó), a beteg kora, és a fertőzés csíraszáma. 5 éven aluli gyermekek rizikója a HUS kialakulására magasabb és a gyermekek halálozási kockázata a dehidráció és a szeptikémia következtében nagyobb. A STEC infekciót fertőzött élelmiszerek, víz, állatkontaktus, vagy emberről-emberre (szorosabb kontaktus a családon belül, a gyermek centrumokban, az idősek otthonában) történő átvitel következtében akvirálják. A STEC fertőzések kezelése alapvetően a rehidráción alapul. Az antibiotikus terápia ellentmondásos, mert az antibiotikumok képesek aktiválni a shiga toxin felszabadulását (lásd a későbbiekben) és ezért klinikai állapotromlást és HUS fellépését idézhetik elő.

A STEC fertőzések az EU-ban epidemiológiai surveillance körébe tartoznak. 2009-ben 3573 bejelentett STEC infekció fordult elő, amelynek felét E. coli O157:H7 szerotípus okozta, 242 HUS eset alakult ki. A németországi járvány kórokozója shiga toxin 2A termelő E coli O104:H4 szerotípusú törzs volt. Ezt a ritka szerotípust ezt megelőzően csak néhány STEC és HUS esetben írták le, azonban sohasem élelmiszerekkel kapcsolatban. A kitörésért felelős törzs a STEC virulencia faktorok szokatlan kombinációját tartalmazta, stx2 gén pozitív volt, továbbá jelen voltak a baktériumokban aat, aggR gének, amelyek az EAEC törzsek jellemzői. Az EAEC rendszerint elhúzódó vizes hasmenéssel jár, elsősorban a fejlődő országokba látogató utazók és gyermekek között fordul elő.  A STEC és az EAEC pathotípusok kombinációja igen ritka, korábban Francia gyermekekben írtak le egy O111:H2 szerotípus által okozott HUS járványt. A 2011-es német járványból izolált törzs multidrug rezisztenciát mutatott, plazmidon kódolt CTX M15 ESBL-t termelt. PFGE (pulse field gel electrophoresis tipizálás) vizsgálattal a német és dán betegekből izolált törzsek azonosnak bizonyúltak.

Korábban az O104:H4 törzs nem volt jelen élelmiszer okozta járványokban és nem került kimutatásra állatokban sem. A virulencia faktorok kombinációja arra utal, hogy a törzs inkább humán, mint állati eredetű. Május 17 - június 13 között 817 HUS esetet jelentettek a járvánnyal kapcsolatban, amelyből Németországban 781 fordult elő. Az összes HUS eset 69%-a nőkben fodult elő, és életkor tekintetében az esetek 88% - a 20 évnél idősebbekben lépett fel. Az előfordult esetek többségében Hamburg és Alsó-Szászország északi részén, Mecklenburg, Nyugat Pomeránia és Schleswig- Holstein tartományokban való tartózkodás szerepelt a kórtörténetben. Három eset az előző területeken tartozkodó egyénekkel való kontaktus révén volt magyarázható (dán, lengyel, norvég).

Május 26-án a hamburgi Közegészségügyi Intézet közleményt adott ki, amelyben arról számoltak be, hogy két, Spanyolországból származó uborkán STEC jelenlétét mutatták ki. A későbbiekben bejelentették, hogy ezek nem a járványt okozó törzsekből származtak. Május 27-én feltételezett epidemiológiai evidenciák alapján a Robert Koch Intézet és a Német Szövetségi Rizikóértékelő Intézet (BFR) azt nyilatkozta, hogy a járvány nyers zöldségek fogyasztásával áll összefüggésben, és elsősorban uborka, paradicsom, és saláta került gyanúba. Azt tanácsolták a lakosságnak, hogy kerüljék ezeknek a zöldségeknek a fogyasztását. A német járvány vizsgálatában szövetségi szinten három nagy intézet töltött be vezető szerepet, a Robert Koch Intézet (közegészségtan), a BFR (az élelmiszerekkel kapcsolatos rizikó), és a BVL, a Szövetségi Fogyasztóvédelmi és Élelmezésbiztonsági Hivatal (a tápláléklánc biztonságával kapcsolatos vizsgálatok). A Robert Koch Intézet epidemiológiai vizsgálatokat, eset-kontroll tanulmányokat és ezek metaanalízisét, a clusterek vizsgálatát, és kohors típusú tanulmányokat végzett.  A nyomonkövetési vizsgálatokban (traceback investigation) a termelőket, a forgalmazókat és az eladókat vizsgálták át.  Feltárták a STEC HUS esetek korábbi élelmiszer fogyasztási anamnézisét. Ennek alapján az adatok arra utaltak, hogy a STEC HUS járvány fellépésével néhány helyi termelőtől származó csíraféle fogyasztása állhat öszefüggésben. 55 betegség cluster (egymással kapcsolatban álló esetek) közül 33 összekapcsolható volt a csírafogyasztással összefüggő táplálék láncolattal. 2011. június 10-én a három szövetségi intézmény együttes megállapítást tett közzé, amelyben felhívta a figyelmet a csírafogyasztástól való tartózkodásra, egyidejűleg feloldotta az uborka, a paradicsom és a saláta fogyasztással kapcsolatban tett tilalmi javaslatát. Több száz mintát vettek a gyanúba került csíratermelő mezőgazdasági területekről, amelyek között volt csíra, mag, víz, és egyéb környezeti minta, de az O104:H4 STEC pathogén törzset egyetlen mintában sem találták meg. Mindössze egy nyers csíramintán mutatták ki a betegséget okozó O104:H4 törzset, amelyet egy családi háztartásból származó nyitott szemetes zsákban találtak. A család tagjai egyébként megfertőződtek a kórokozóval.

A németországi STEC járvány ezideig a második legnagyobb ilyen kitörés a világon. A legnagyobb kitörés során a Sakai EHEC törzs (később részletesen ismertetjük) több mint 6000 iskoláskorú gyermeket (több mint 9000 személyt) fertőzött meg Japánban, és a közvetítő a fehér retek csíra volt. Az ECDC közlemény a kockázat értékelés kapcsán hangsúlyozta, hogy epidemiológiai szempontból a járvány sajátossága, hogy 88%-ban 20 év feletti emberek, és 2/3 részben nők betegedtek meg, amit azzal magyaráznak, hogy Németországban az utóbbi időben megnőtt a csírafogyasztás iránti érdeklődés. Az is a járvány jellemzője, hogy a fertőző forrással történő expozíció csak Észak-Németországban fordult elő, és nem mutatkozott annak jele, hogy Németországon kívül történt volna fertőzött élelmiszer fogyasztása. Három esetben felvethető, hogy Németországból visszatért utazókkal való direkt kontaktus következtében alakult ki a kórkép (ECDCRAPID RISK ASSESSMENT UPDATE.Outbreak of Shiga toxin-producing E. coli (STEC) O104:H4 2011 in the EU 8 July 2011 (updated from 29 June).

Hangsúlyozták, hogy az élelmiszerláncban dolgozó személyek a lánc minden szintjén, a fogyasztók pedig az élelmiszerek kezelése során tartsák be a személyi higiénés előírásokat, amelyek között a kézmosás kiemelkedő jelentőségű. Javasolták a nyersen fogyasztott zöldségek bő vízzel történő lemosását, ha lehetséges, a meghámozást, valamint minden intézkedés elvégzését annak elkerülésére, hogy a nyersen fogyasztott élelmiszerek enterális pathogénekkel kontaminálódjanak. Felhívták a figyelmet, hogy a csírafogyasztás közvetítője lehet enterális pathogének okozta járványoknak és a pathogének jelen lehetnek a magvakon is, amelyekből a csírákat növesztik. Azt tanácsolták a lakosságnak, hogy kerüljék az otthoni csíranövesztést és annak fogyasztását. Az EU tagországokban pedig szükségesnek tartják a folyamatos monitorizálást, illetve olyan laboratóriumok fenntartását, amelyek képesek a kórokozók gyors azonosítására.

Az Országos Epidemiológiai Központ az Epinfo hasábjain a németországi E. coli enteritis és HUS járványról több alkalommal adott tájékoztatást (pl. Országos Epidemiológiai Központ. EPINFO 18. évfolyam 20. szám 2011. május 27. Shiga toxin termelő E. coli (STEC) által okozott járvány Németországban. 209-214).

Az EFSA (European Food Saffety Authority) és az ECDC közös kockázatértékelésben számoltak be 2011. június 29-én a Franciaországban, Bordeaux-ban kialakult HUS clusterről. Június 24-én alakult ki az első, véres hasmenéssel és HUS-val társuló betegség cluster 8 betegben, Bordeaux környékén. Június 28-ra ebben a régióban 15 véres hasmenést és HUS előfordulást észleltek. Közülük 11-en Bégles-ben vettek részt egy nyílvános közösségi eseményen, 9-en fogyasztottak csírákat (lucerna), rukkolát, mustárt. A 15 beteg közül 8 esetben alakult ki HUS, ezek közül hét 31-64 év közötti nő volt, 11 betegnél a betegség kialakulása 7-12 nappal később jelentkezett. Három betegnél azonosították az O104:H4 E. coli törzset. A szerotípuson kívül a német törzzsel hasonlóságot mutatott az antibiotikum rezisztencia profil is. A csírákat helyi mezőgazdasági létesítményekben növesztették Franciaorzságban és nem volt kapcsolat a németországi járvány kapcsán felmerült mezőgazdasági létesítményekkel. A kezdeti vizsgálatok azt mutatták, hogy a franciországi csírák magjait egy UK-ban működő társaság forgalmazta. Június 28-án Svédországban is előfordult egy eset, amelyet E. coli O104:H4 törzs okozott, de semmilyen kapcsolat nem volt kimutatható sem Németországban járt személyekkel, sem csírafogyasztással. Az EU visszakövetési vizsgálatok előzetes adatai felvetették, hogy a lucerna magvakat (fenugreek, görögszéna) 2009-2010-ben Egyiptomból importálták, és esetleg a 2009-es import a francia, a 2010-es import a német kitöréssel lehet kapcsolatban. A legutolsó svéd esetet azonban ez sem magyarázza meg. Mindenesetre a visszakövetéses tanulmányok hangsúlyozzák az élelmiszerlánc összetettségét és a visszakövetés nehézségeit, mert számos forgalmazón, kiskereskedőn, eladón keresztül érkezik meg a termék a mezőgazdasági intézményekhez. Figyelemre méltónak tartják azt is, hogy a csíráztatásra használt magvak gyakran magkeverékként érkeznek és az ismételt átcsomagolások során történhet keresztkontamináció.

Az ECDC közlemény összefoglaló részében hangsúlyozza, hogy a görögszéna csíra lehet az O104:H4 fertőzésnek közös közvetítője Németországban és Franciaországban (EFSA/ECDC JOINT RAPID RISK ASSESSMENT. Cluster of haemolytic uremic syndrome (HUS) in Bordeaux, France, 29 June 2011. Updated from 24 June, Enter-net Quarterly VTEC Report 2007/1 January-March 2007, Enter-net Quarterly VTEC Report 2007/2 April-July 2007,FoodNet Population Survey, 2006-2007). A németországi járvány részletei az összefoglaló végén találhatók.

Az E. coli baktérium leírója Theodor Escherich (1857-1911) osztrák gyermekgyógyász és bakteriológus volt.

  

Theodor Escherich (1857-1911)

A kép forrása: Internet

Habilitációs tézisében az enterobacteriumok szerepét tárgyalta az emésztés fiziológiájában. Escherich 1885-ben a baktériumot Bacillus coli communisnek nevezte. Az Escherichia coli elnevezés részben Migulatól (1895, Bacillus coli), részben Castellanitól és Calmerstől (1919, Escherichia coli) származik, hivatalosan csak 1958-ban lett ez a baktérium neve.

Az Escherichia coli species tudományos klasszifikációja szerint a baktériumok domainjébe, a proteobaktériumok phylumába, a gamma proteobaktériumok osztályába, az enterobacteriales rendbe, az enterobacteriaceae családba, az escherichia genusba tartozik.

Az Escherich által vizsgált eredeti törzs elveszett, egy újabb törzs (neotípus) a jelenleg kiválasztott reprezentatív alaptörzs, az ATCC11775 (American Type Culture Collection), vagy NCTC9001 (National Collection of Type Cultures). Csirkékben pathogén, szerotípusa O1:K1:H7. A legtöbb vizsgálatban jelenleg az O157:H7, a K12 MG1655 és a K12 W3110 szerepel reprezentatív E. coli törzsként.

Több mint 100 millió éve vált szét az Escherichia és a Salmonella genus, amely megfelel a gazda élőlényeik divergenciájának, az Escherichia-é az emlősök, a Salmonella-é a madarak és reptiliák. Ezt követően 20-30 millió évvel ezelőtt az ős Escherichia törzs öt speciesre vált szét, az E. albertii-, az E.coli-, az E. fergussonii-, az E. hermannii-, és az E. vulneris-re.

A baktérium Gram negatív festődésű. A módszer Hans Christian Gram (1853-1938) dán kutató munkájának eredménye, aki 1884-ben felfedezte, hogy a baktériumokat két csoportra lehet osztani aszerint, hogy a festési eljárással lilára festhetők-e, vagy sem. Gram-pozitív baktériumok azok, amelyek kékre/lilára színeződnek és Gram-negatív baktériumok azok, amelyek rózsaszín/piros színt kapnak.

AzE. coli fakultatív anaerob, sporát nem képez, pálcika alakú, 2 um hosszú, 0,5 um átmérőjű, optimális növekedési hőmérséklete 37 oC, de néhány laboratóriumi törzs képes 49 oC-ig terjedő hőmérséklet tartományban szaporodni. Peritrich csillói vannak és a törzsek általában motilisek.

Élettani tulajdonságai alapján ismerik fel, mivel sok más faj hasonlít hozzá.

A széklet tenyésztés során az E. coli baktériumok tenyésztése MacConkey agaron, eosin metilénkék (EMB) tartalmú agaron, illetve összetett, chromogént tartalmazó agaron (pl. Oxoid Brillance E. coli/coliform Selective Agar) történik, amelyeken az Enterobacteriaceae család, illetve az E. coli család szelektíven nő, és biokémiai jellemzői révén azonosítható.

Az E. coli törzsek 90% - a laktóz fermentáló, de számos diarrhogén E. coli törzs laktóz negatív. Az E. coli törzsek 99% - a indol pozitív.

Ha sok baktériumot várnak, akkor a mintát MacConkey-agarra (Alfred Theodore MacConkey,1861-1931, brit bakteriológus, a liverpooli Királyi Szennyvíztároló Intézet munkatársaként fejlesztette ki a bélbaktériumok tenyésztésére és izolálására alkalmas, róla elnevezett táptalajt) oltják, ha keveset, akkor összetett táptalajon tenyésztik a baktériumokat.

A MacConkey-agar sötétvörös baktériumkolóniáinak élettani tulajdonságait IMViC-teszttel (mikrobiológiai laboratóriumi teszt a coliform baktériumok azonosítására, I-indol, M-methyl red pH indikátor, V- Voges-Proskauer test /alfa naphthol és KOH, i: hozzáadott betű, C- citrát) vizsgálják tovább azonosítás céljából.

Az altípusok megállapítására szerológiai vizsgálatokat végeznek. Az egyes törzseket azonosító gyorstesztek ELISA (enzyme linked immunosorbent assay)- vagy PCR (polymerase chain reaction)-eljáráson alapszanak.

A specifikus virulencia faktorok megismerése előtt a pathogén törzsek azonosítása szerotipizálással történt.  Kauffman 1944-ben kidolgozott szerotipizálási sémája módosított formában ma is használatos. A szomatikus (O), flagelláris (H) és a kapszuláris (K) felszíni antigén profil szolgál azonosításra. Az O antigének határozzák meg a szerocsoportokat. A K antigén jelenlétének kimutatása eredetileg annak alapján történt, hogy ha a törzs nem mutatott agglutinációt az O antiszérummal, melegítették a mintát, és ezután a törzs agglutinálhatóvá vált. A későbbiekben a protein struktúrák, így a fimbriális antigének is kikerültek a K antigének közül és F jelölést kaptak. K antigénként csak az acidikus poliszaccharidok maradtak meg.

Az O és H antigének definiálják az izolátumok szerotípusát.  Egyes specifikus szerocsoportok bizonyos klinikai tünetcsoportokkal mutatnak kapcsolatot. Nem maguk a szerológiailag detektálható antigének a virulencia tényezők, de azonosítható kromoszomális markerekként szerelnek, amelyek jelenléte specifikus virulenciájú klónokra utalhat.

A hasmenést okozó E. coli törzsek jellemző O és H antigénjei  Nataro közlése alapján (Nataro JP, Kasper JB. Diarrhaegenic Escherichia coli. Clin Microbiol Rev 11, 142-201, 1998.).

  

O szerocsoport

társult H antigének

ETEC

O6

H16

 

O8

H9

 

O11

H27

 

O15

H11

 

O20

NM

 

O25

H42, NM

 

O27

H7

 

O78

H11, H12

 

O128

H7

 

O148

H28

 

O149

H10

 

O159

H20

 

O173

NM

EPEC

O55

H6, NM

 

O86

H34, NM

 

O111

H2, H12, NM

 

O119

H6, NM

 

O125ac

H21

 

O126

H27, NM

 

O127

H6, NM

 

O128

H2, H12

 

O142

H6

EHEC

O26

H11, H32, NM

 

O55

H7

 

O111ab

H8, NM

 

O113

H21

 

O117

H14

 

O157

H7

EAEC

O3

H2

 

O15

H18

 

O44

H18

 

O86

NM

 

O77

H18

 

O111

H21

 

O127

H2

 

O?

H10

EIEC

O28ac

NM

 

O29

NM

 

O112ac

NM

 

O124

H30, NM

 

O136

NM

 

O143

NM

 

O144

NM

 

O152

NM

 

O159

H2, NM

 

O164

NM

 

O167

H4, H5, NM

1. Táblázat EAEC  O szerotípusok még: O55, O125, O126, és O128, NM: non motile

A coli és a coliform baktériumok képesek DNS-üket bakteriális konjugáció, transzdukció és transzformáció révén átadni más baktériumoknak, ami lehetővé teszi a genetikus állományuk horizontális terjedését a meglévő populációban. A jelenségnek szerepe van a közelmúltban lezajlott németországi járvány során izolált újnak tartott species létrejöttében.

Ilyen folyamat játszhatott szerepet a Shiga toxin Shigellákból az E. coli törzsbe, pl. az O157:H7-be való átkerülésben, ami bakteriofág közvetítésével történt.

Az E. coli speciesen belül rendkívül nagyfokú a fenotípus és a genotípus diverzitása. Nagyszámú E. coli izolátum genomjának a szekvencia analízise azt mutatta, hogy a genom mindössze 20%-a közös valamennyi törzsben. Evolúciós és filogenetikai szempontból négy Shigella species (S. dysenteriae, flexneri, boydii, sonnei) rokonítható az E coli törzsekkel (a taxon álruhában jelenség), viszont két coli törzs, az E. albertii és az E. fergussonii távolabbi képviselők.

A genom plaszticitása miatt új coli törzsek alakulhatnak ki természetes biológiai folyamatok, mutációk, génduplikációk, és horizontális génátvitelek révén.

Az első komplett E. coli genom DNS szekvenciát, az MG1655-t Frederic Blattner 1997-ben publikálta a Science hasábjain.

Frederick Blattner

A kép forrása: Internet

(Blattner FR, Plunkett G, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA,. Goeden MA, Rose DJ, Mau B, Shao Y. The complete genome sequence of Escherichia coli K-12. Science 1997, 5, 1453-1462.)

A pathogén E. coli törzsek számos virulencia stratégiával rendelkeznek, és ezeket képesek egymásnak átadni. Valamennyi pathovariánsnak megvannak a sajátos virulencia faktorai, amelyek az elmúlt időszakban váltak ismertté. Mobilis genetikus elemek felvétele, illetve kiválása a baktériumok genomjából alakítja ki a pathogén baktériumok végleges génösszetételét. A horizontális géntranszfer fontos mechanizmus a virulencia faktorok átvitelében az egyes pathovariánsok között. Ezek a pathogenitást alakító gének alapvető fontosságúak a baktériumok alkalmazkodásában és túlélésében különböző körülmények között. A virulencia gének nagyobb clusterekben ún. pathogenicitási szigeteken (pathogenicity islands, PAI) helyezkednek el, előfordulhatnak plazmidokon, és mobilis elemek révén integrálódhatnak a baktériumok kromoszómájába is. A virulencia gének általában nincsenek jelen nem pathogén baktérium törzsekben. A PAI-k illetve, a bennük jelenlévő gének általában mobilis genetikus elemek, inzerciós szekvenciák, transzpozonok, vagy bakteriofág szekvenciák által határolt területeken helyezkednek el, és gyakran tRNS gének szomszédságában inzertálódnak. Az E. coli törzsek virulencia génjei elhelyezkedhetnek a PAI-kon kromoszomálisan, a plazmidon, vagy a profágok területén (ezek is kromoszomálisan lokalizáltak). A legtöbb profág defektív, de képes lehet infektív partikulum kialakítására is. A horizontális géntranszfer következtében a recipiens baktérium kolóniában a szelektív környezeti nyomás olyan variánsokat alakít ki, amelyek a szelekciós tényezők jelenlétében is képesek túlélni. Ez a folyamat szelektálja az egyre virulensebb kórokozó organizmusokat, amelyek végül epidemiákat okozhatnak, mint az EHEC (enterohaemorrhagic E. coli) és EIEC (enteroinvasive E. coli) törzsek. Jelenleg úgy gondolják, hogy a pathovariánsok evolúciója nem baktérium sejtvonal specifikus módon alakul. Az EHEC törzsek virulencia faktorai egymástól függetlenül, különböző E. coli speciesekből kerültek át az adott virulens törzsbe. A pathogén E. coli törzsek egymástól genetikusan különböznek, genomjuk akár 1 millió bázissal is nagyobb lehet, mint a kommenzális izolátumoké, főként azért, mert különféle PAI génclustereket akviráltak. A szekvencia analízis alapján úgy gondolják, hogy a coli törzsek core genomja mintegy 2200 génből áll. A pángenom pedig ezen kívűl még több mint 13000 génből áll. A legtöbb E. coli pathogén törzs több mint 5000 gént tartalmaz, amelynek csak a fele a core genom része.

Ennek következtében a pathogén izolátumokban jelentős mértékű genetikus diverzitás és plaszticitás figyelhető meg. Az UPEC (uropathogenic E. coli) CFT073 törzs genomja 13 genomikus szigetet tartalmaz, amely a génállomány több mint 13%-a. Érdekes módon azonban a virulencia faktorok megoszlása az UPEC izolátumok között heterogén, nem csupán egy faktor felelős az uropathogenezisért. A komparatív genom analízis 131 UPEC specifikus gént azonosított, amelyek legtöbbje jelenleg hipotetikus protein génje.

Az EPEC (enteropathogenic E. coli) törzsek komplett genom szekvenciájának megismerése alapján kiderült, hogy az E. coli K12 törzshöz képest 400-val több gént tartalmaznak. Az EPEC izolátumok azonban az EHEC O157:H7 törzshöz képest 650 génnel, az UPEC CFT073 törzshöz képest 770 génnel tartalmaznak kevesebbet. Úgy látszik, hogy az EPEC törzsek pathogenitásához nyilvánvalóan kisebb virulencia faktor repertoár szükséges, mint a többi pathovariáns számára.

Az EIEC törzsekben van jelen a legtöbb rekombináció és pathoadaptáció. A pINV (p plasmid, inv invasion) virulencia plazmid biztosítja horizontális géntraszfer révén az invazivitást az EIEC törzsek számára, azonban ezen kívűl még egy genom deléció, az ún. fekete lyuk, a lizin dekarboxiláz gént (cadA) tartalmazó génterületen is szükséges az intracellularis életstílushoz történő adaptációhoz. Ennek alapján nyílvánvaló, hogy gének elvesztése és akvirálása egyaránt hozzájárul az E. coli pathovariánsok  kialakulásához és genetikus diverzitásához.

Jelenleg az NCBI (National Center for Biotechnology Information, www.ncbi.nlm.nih.gov adatbázisában 235 E. coli,   24 O104:H4, 28 O157:H7 EHEC és ezen kívül még 9 STEC termelő E. coli törzs szekvenciája található meg.

A genom szekvencia 80%-a a különböző speciesekben rendkívül változékony. Az individuális genomok általában 4000-5500 gént tartalmaznak, de az E. coli baktériumokban talált különböző gének össz száma, a pangenom több mint 16000 gén. A jelenleg uralkodó elképzelés az, hogy az E. coli pangenom kétharmada más speciesekből származik, és horizontális géntranszfer révén került át E. coli törzsekbe.

A baktériumokban jelen lévő plazmidok szekvencia adatai is megtalálhatók az adatbázisban. Több izolátum nem betegekből származik, laboratóriumi törzsek, referencia/összehasonlítási célokat szolgálnak.

A Shigella törzsek filogenetikailag igen közeli rokonságban állnak az E. colitörzsekkel. Az enteroinvazív, enteroaggregatív és enterohemolitikus E. colitörzsek számos közös virulencia pathomechanizmussal rendelkeznek.

Az NCBI adatbázisban szereplő ismertebb E. coli törzsek genomjának néhány adata:

Escherichia coli O157:H7 str. EC4115, komplett genom 5,572,075 bp circularis DNS

Escherichia coli O157:H7 str. TW14359, komplett genome 5,528,136 bp circularis DNS Escherichia coli O157:H7 str. Sakai DNA, komplett genom 5,498,450 bp circularis DNS Escherichia coli O157:H7 EDL933, komplett genom 5,528,445 bp circularis DNS

Escherichia coli O55:H7 str. CB9615, komplett genom 5,386,352 bp circularis DNS Escherichia coli E24377A, komplett genom 4,979,619 bp circularis DNS

Escherichia coli 55989 kromoszóma, komplett genom 5,154,862 bp circularis DNS Escherichia coli 042 komplett genom 5,241,977 bp circularis DNS

Escherichia coli W, komplete genom 4,900,968 bp circularis DNS

Escherichia coli ATCC 8739, komplett genome 4,746,218 bp circularis DNS

Escherichia coli IAI1 kromoszóma, komplett genom 4,700,560 bp circularis DNS

Escherichia coli O26:H11 str. 11368 DNS, komplett genom 5,697,240 bp circularis DNS Escherichia coli SE11 DNS, komplett genom 4,887,515 bp circularis DNS

Escherichia coli IAI39 kromoszóma, komplett genom 5,132,068 bp circularis DNS

Escherichia coli SMS-3-5, komplett genom 5,068,389 bp circularis DNS

Escherichia coli str. K12 substr. W3110 DNA, komplett genom 4,646,332 bp circularis DNS Escherichia coli str. K-12 substr. MG1655, komplett genom 4,639,675 bp circularis DNS Escherichia coli DH1, komplett genom 4,630,707 bp circularis DNS

Escherichia coli DH1 (ME8569) DNS, komplett genom 4,621,430 bp circularis DNS Escherichia coli ETEC H10407, komplett genom 5,153,435 bp circularis DNS

Escherichia coli B str. REL606, komplett genom 4,629,812 bp circularis DNS

Escherichia coli BW2952, komplett genom 4,578,159 bp circularis DNS

Escherichia coli str. K12 substr. DH10B, komplett genom 4,686,137 bp circularis DNS Escherichia coli O103:H2 str. 12009 DNA, komplett genom 5,449,314 bp circularis DNS Escherichia coli O111:H- str. 11128 DNA, komplett genom 5,371,077 bp circularis DNS Escherichia coli UMN026 kromoszóma,, komplett genom 5,202,090 bp circularis DNS Escherichia coli 536, komplett genom 4,938,920 bp circularis DNS

Escherichia coli SE15 DNA, komplett genom 4,717,338 bp circularis DNS

Escherichia coli ED1 kromoszóma, komplett genom 5,209,548 bp circularis DNS

Escherichia coli S88 kromoszóma, komplett genom 5,032,268 bp circularis DNS

Escherichia coli APEC O1, komplett genom 5,082,025 bp circulars DNS

Escherichia coli IHE3034, komplett genom 5,108,383 bp circularis DNS

Escherichia coli LF82 kromoszóma, komplett szekvencia 4,773,108 bp circularis DNS Escherichia coli O83:H1 str. NRG 857C, komplett genom 4,747,819 bp circularis DNS Escherichia coli BL21(DE3), komplett genom 4,558,947 bp circularis DNS

Escherichia coli BL21(DE3), komplett genom 4,558,953 bp circularis DNS

Escherichia coli BL21-Gold(DE3)pLysS AG', komplett genom 4,570,938 bp circularis DNS Escherichia coli 0127:H6 E2348/69 komplett genom, törzs E2348/69 4,965,553 bp circularis DNS

Escherichia coli ABU 83972, komplett genom 5,131,397 bp circularis DNS

Escherichia coliCFT073, komplett genom 5,231,428 bp circularis DNS

Escherichia coli UTI89, komplett genom 5,065,741 bp circularis DNS

Escherichia coli UM146, komplett genom 4,993,013 bp circularis DNS

Escherichia coli HS, komplett genom 4,643,538 bp circularis DNS

Escherichia fergusonii ATCC 35469 kromoszóma, komplett genom 4,588,711 bp circularis DNS

Összehasonlításul néhány ismert genom mérete (Wikipedia, genome  alapján)

Organizmus

 

  Genom   

méret

   (bázispár)

 

             megjegyzés

Virus

Bacteriophage MS2

3,569

   3.5 kb

elsőként szekvenált

Virus

SV40

5,224

   5.2 kb

RNS genom

Virus

Phage Φ-X174

5,386

   5.3 kb

elsőként szekvenált  DNS genom

Virus

HIV

9,749

    9.7 kb

 

Virus

Phage λ

48,502

    48 kb

 

Virus

Mimivirus

1,181,404

    1.1 Mb

legnagyobb ismert vírus genom

Baktérium

Haemophilus influenzae

1,830,000

    1.8 Mb

elsőként szekvenált élő organizmus,    1995

Baktérium

Carsonella ruddii

159,662

    159 kb

legkisebb nem vírus genom.

Baktérium

Buchnera aphidicola

600,000

    600 kb

 

Baktérium

Wigglesworthia glossinidia

700,000

    700 kb

 

Baktérium

Escherichia coli

4,600,000

     4.6 Mb

 

Baktérium

Solibacter usitatus (strain Ellin 6076)

9,970,000

     9.9 Mb

legnagyobb ismert bakteriális genom

Amoeboid

Polychaos dubium

 670,000,000,000

     670 Gb 

legnagyobb ismert genom, amoebozoa

Növény

Arabidopsis thaliana

157,000,000

     157 Mb

elsőként szekvernált növényi genom 2000

Növény

Genlisea margaretae

63,400,000

       63 Mb

legkisebb virágos növény genom 2006

Növény

Fritillaria assyrica

130,000,000,000

     130 Gb

 

Növény

Populus trichocarpa

480,000,000

     480 Mb

első szekvernált fa genomja 2006

Növény

Paris japonica

150,000,000,000

  150 Gb

legnagyobb növényi genom, (Japán halvány szirom, zászpaféle)

Moha

Physcomitrella patens

480,000,000

  480 Mb

első szekvenált bryophita genom 2008

Élesztő

Saccharomyces cerevisiae

12,100,000

  12.1 Mb

első szekvenált eukaryota genom1996

Gomba

Aspergillus nidulans

30,000,000

   30  Mb

 

Nematoda

Caenorhabditis elegans

100,300,000

  100 Mb

első soksejtű szekvenált állati genom 1998

Nematoda

Pratylenchus coffeae

20,000,000

   20 Mb

legkisebb ismert állati genom

Rovar

Drosophila melanogaster

130,000,000

  130 Mb

ecetmuslica

Rovar

Bombyx mori

530,000,000

   530 Mb

selyem lepke

Rovar

Apis mellifera

236,000,000

   236 Mb

méh

Rovar

Solenopsis invicta

480,000,000

   480 Mb

tűzhangya

 

Hal

 

Tetraodon nigroviridis

 

385,000,000

    

    3.9 Mb

legkisebb ismert gerinces genom (puffer hal)

Emlős

Homo sapiens

3,200,000,000

     3.2 Gb

 

Hal

Protopterus aethiopicus

130,000,000,000

    130 Gb

legnagyobb ismert gerinces genom (márványos tüdőshal)

bp: bázispár, kb: kilo bázis pár = 1,000 bp, Mb = mega bázis pár = 1,000,000 bp, Gb = giga bázis pár = 1,000,000,000 bp.

Egyes E. coli törzsek jellemzése

Az E. coli K 12  MG1655 altörzs, nem patogén, viszonylag csekély genetikus manipuláció alkalmazásával tartották fenn. Eltávolították a lambda bakteriophagot és az F plazmidot. A törzs a Joshua Lederberg (1925-2008, Nobel díj 1958, bakteriális konjugáció, megosztva EL Tatummal és G Beadly-vel) által vizsgált W1485 törzsből származik, amely az első, betegből 1922-ben izolált K-12 törzsből (EMG2, ebben jelen volt a lambda prophag és a fertilitási, F faktor plazmid) ered. Ennek a törzsnek a genom szekvenciáját ismerték meg legelőször. Frederick Blattner és mtsai 1997-ben publikálták a Science hasábjain. A baktérium genomja 2584 operonba rendeződve 4288 fehérjét kódoló gént, 7 riboszómális RNS operont és 86 transzfer RNS gént tartalmaz, 4 639 680 bázispár hosszú. A genomban transzpozábilis genetikus elemek, ismétlődő elemek, profágok és bakteriofág szekvencia maradványok is jelen vannak. A kódoló szekvenciák denzitása igen nagyfokú, az átlagos géntávolság 118 bp.

Az E coli K 12 W3110 közeli rokona az MG1655 törzsnek (a W1485 altörzsből származik midkettő). Ebben a törzsben nincs jelen a lambda prophag és F plazmid. A két törzs genomjának összehasonlításából kiderült, hogy azok nem identikusak, hanem különböző vonalak. A genom mérete 4 646 330 bázispár (4 646 308 bp a kódoló szakasz) és 4227 fehérjét kódol.

A K 12 altörzs a DH10B laboratóriumi törzs.  A genom mérete 4 750 000 bp (4 658 613 bp a kódoló szakasz), 4126 génje 4126 fehérjét kódol.

Az EHEC törzsek, így az O157:H7 EC41115 az előzőekhez képest méretüket tekintve nagyobbak, az utóbbi komplett genomja 5 572 075 bp, a gének száma 5477, a kódolt proteinek száma 5477. A törzs tartalmazza a pO157 nagy plazmidot, amely 94 644 bp (circularis) és tartalmazza a pEC4115 kisméretű plazmidot is, amely 37 452 bp circularis DNS. A törzs a hamburger betegség kórokozója, az amerikai 1993-as Jack in the Box EHEC hemolitikus uremiás szindróma (HUS) járvány során izolálták. A K12-es törzsekhez képest számos különbség mutatkozik a genomban. Többek között tartalmaz kilenc nagy pathogén szigetet, amelyek számos virulencia faktort kódolnak, többek között a  3-as típusú szekréciós rendszert (TTSS, type three secretion system), LEE lokuszt (Locus of Enterocyte Effacement) számos toxint és adhezint, fimbriális gén clustereket és vas felvételétkódoló rendszert. A pO157 (p plasmid) plazmidon szintén jelen vannak pathogenitással összefüggő gének.

Egy másik E coli O157:H7 EHEC törzs az EDL933. Ez a törzs is hamburger betegség járványból került izolálásra, a teljes genom mérete 5 528 445 bp, 5395 génje és 5449 fehérjéje ismert. Ez az altörzs is tartalmaz pO157 nagy plazmidot, amelynek mérete itt 92 077 bp (circularis). Az előző O157:H7 törzshöz hasonlóan ebben is jelen van legalább kilenc nagy pathogén sziget.

Az E. coli O157:H7 Sakai törzset Japán kutatók a Sakai nagy járvány során izolálták és szekvenálták (1997). A teljes genom szekvencia 5 498 450 bp, 5221 gén és 5447 fehérje került azonosításra. A törzs két plazmidjának szekvenciája is ismert, az egyik a pO157 nagy plazmid, ennek mérete itt 92 721 bp, és a pOSAK 1 Sakai plazmid, amelynek mérete 3306 bp (circularis). Ez az EHEC törzs is tartalmaz legalább kilenc nagy patogenitási szigetet, az előzőekben ismertetett pathogén tényezőkkel.

Ismert az O157:H7 E. coli TW14359  törzs szekvenciája is. Ezt a törzset az USA nyugati részén 2006-ban zajló EHEC járvány során spenótról izolálták. A teljes genom mérete 5 528 136 bp, tartalmazza a pO157 nagy plazmidot, amelynek mérte 94 601 bp (circularis). Az azonosított gének száma 5365, a fehérjék száma 5373. Hasonlóan a másik három O157:H7 EHEC törzshöz, a genetikai állomány itt is tartalmaz legalább kilenc nagy pathogén szigetet az előzőekben ismertetett virulencia faktorokkal.

További EHEC törzs az O26:H11 11368 altörzs, amit humán EHEC betegségből izoláltak. Ebben a baktériumban négy plazmidot találtak, a pO26 1-es plazmidot, amelynek mérete 85 167 bp (circularis), a pO26 2-es plazmidot mérete 63 365 bp, a pO26 3-as plazmidot, amelynek mérete 5686 bp, és a pO26 4-es plazmidot, amelynek mérete 4073 bp (valamennyi circularis). A teljes genom mérete 5 697 240 bp, a gének száma 5519, a fehérjék száma 5519.

Az enteropatogen (EPEC) E coli O127:H6 E2348/69 altörzset egy fatális infantilis diarrhoeae esetből izolálták és 2008-ban írták le. Az EPEC törzs indukálta diarrhoeae során a vékonybél sejtjein attaching and effacing laesio (tapadási és lecsupaszitási lézió) alakul ki, citoszkeletális átrendeződés és a bakteriális toxin gazdasejtbe injektálását végző rendszer génjei (TTSS rendszer) is jelen vannak. A törzs teljes genomjának mérete 4 965 553 bp, a nagy plazmid, pMAR 2 mérete 97 978 bp, a kis plazmid pE2348 2 6147 bp (mindkettő circularis), a gének száma 4651, a fehérjék száma 4653.

Az enteropathogen törzsektől különbözik az uropathogen E. coli UTI89 (UTI urinary tract infection) törzs genomja. Ezt a törzset egy nőbetegben zajló nem komplikált cystitis során izolálták. A törzs egér modellben bizonyítottan cystitist idézett elő. A teljes genom mérete 5 065 741 bp, egy nagy plazmid van jelen a baktériumban, mérete 114 230 bp (circularis). A gének száma 5165, a fehérjék száma 5211.  A törzs szekvenciáját 2006-ban publikálták, négy pathogenicitási szigetet tartalmaz. A plazmidja az F plazmidhoz hasonló és szintén tartalmaz virulencia géneket. A vas felvételi rendszer génjeinek pozitív szelekciója figyelhető meg. Az egészséges emberek coli izolátumaiban megfigyelhető génekhez képest pozitív szelekció észlelhető a fepE (ferric enterobactin /enterochelin transporter), az LPS (lipopolisaccharid) O antigén komponens hosszának regulátor proteinje, az amiA (N-acetylmuramoyl-l-alanine amidase) és az ompC (outer membran protein C) gének esetében.

Összehasonlító analízisre több az NCBI adatbázisban szereplő coli törzs szolgálhat, így az

E. coli BL21-Gold (DE3)pLysS AG (4228 gén és protein, genom hossza 4 570 938 bp), laboratóriumi törzs, az E.coli 042  (5 241 977 bp és egy pAA plazmid 113 346 bp, összesen 4922 protein), az E. coli BREL 606 (4 629 812 bp, 4204 gén és 4209 protein).

További jellemzett törzsek:

E. coli BL21 (DE3) 4 558 953 bp, 4159 fehérje

E. coli BW2952 4 578 159 bp, 4084 gén és 4084 fehérje

E. coli DH1 4 630 707 bp, 4160 protein, 4160 fehérje

E. coli ED1a 5 209 548 bp, 4918 gén és 4915 fehérje

E. coli HS  4 643 538 bp, 4377 gén és 4384 fehérje, ez a törzs 09 szerotípusú, colonizálja az emberi gastrointestinalis traktust, de nem okoz betegséget.

E coli IAI 1 08 szerocsoportú törzs virulens, 4 200 560 bp, 4349 gén, 4354 fehérje

Komparatív genom analízisre alkalmas törzsek:

E coli K011, 4 920 168 bp, 4653 fehérje

E. coli NA 114, 4 935 241 bp, 4873 protein

E. coli SE 11, 4 887 515 bp, 4998 gén és 5002 fehérje

E. coli SE 15, 4 717 338 bp, 4488 fehérje

E. coli UMNF18, 5 239 207 bp, 5628 fehérje

E. coli W, 4 900 968 bp, 4606 protein

Távlatilag az Umbrella project keretében összehasonlításra kerülnek a törzsek genomjai a pathogén coli törzsekével. Ezekben az említett törzsekben számos plazmidot találtak, amelyek szekvenciája szintén ismertetésre került.

Az adatbázisban szerepelnek uropathogén törzsek (UPEC uropathogenic E. coli), ezek a következők:

E. coli 536, 4 938 920 bp, 4619 gén 4629 fehérje, németországi akut pyelonephritisből került izolálásra.

Általában UPEC törzsek felelősek a nozokomialis UTI-k (urinary tract infection) 40%-ért. Az 536-os törzs 5 pathogén szigetet tartalmaz és K15 capsula proteint.

Az E. coli ABU 83927 aszimptomatikus bakteriuria során került izolálásra, 5 131 397 bp, 4796 fehérjét kódol.

Az E. coli CFT073 UPEC törzs, O6:K2:H1 szerotípusú, egyike a leggyakoribb nem kórházi UTI kórokozóknak. 5 231 428 bp, 5333 gént és 5379 fehérjét tartalmaz.

Az UPEC és az EHEC törzsek közötti fontosabb különbségek a következők:

Az UPEC törzsekben nincs jelen a III-as típusú szekréciós rendszer, a plazmidokkal illetve fágokkal asszociált pathogenitási szigetek. Az UPEC törzsek viszont rendelkeznek fimbriális operonokkal, elsősorban a Pap pílus termelődését irányító génekkel és más, a vizelet elvezető rendszer colonizációját lehetővé tevő virulencia faktorokkal.

Szintén UPEC törzs az E. coli IAI 39, amely O7:K1 szerotípusú, 5 132 068 bp, 4730 gént és 4732 fehérjét tartalmaz.

UPEC kórokozó az E. coli UMNO26, amely szintén O7:K1 szerotípusú, 5 202 090 bp, 4832 gént és 4826 fehérjét tartalmaz.

Az E. coli UTI89 négy pathogén szigetet tartalmaz és pUTI89 plazmidja 114 230 bp, circularis, hasonló az F plazmidhoz, a genom 5 065 741 bp méretű, 5162 gént és 5211 fehérjét tartalmaz.

Az NCBI adatbázisában szerepelő meningeális E. coli kórokozók a következők:

E coli IHE 3034, O18:K1:H7 szerotípusú, ST95 (sequence type, MLST, multi locus sequence typing), neonatalis meningitisből került izolálásra 1976-ban Finnországban, 5 108 383 bp hosszú, 4757 fehérjét tartalmaz. Az E. coli S88 O45:K1 szerotípusú, neonatalis meningitisből izolálták, a genom hossza 5 032 268 bp, 4694 gén és 4696 fehérje.

A szekvenált coli genomok között szerepel kiterjedt rezisztenciát mutató coli törzs is, az

E. coli SMS-3-5, amely toxicus fémekkel kontaminált területről Dél-Kaliforniában került izolálásra, számos antibiotikumra rezisztens, a genom mérete 5 068 389 bp, 4912 gént, 4913 fehérjét és 4 plazmidot tartalmaz (pSMS35-3: 3565bp, a -4: 4074bp, a -8: 8909 bp és a -130: 130 440 bp méretű plazmidokat).

Az adatbázisban szerepelnek Crohn betegséggel társult E. coli törzsek, melyek a következők: E coli LF82,  egy AIEC (adherens-invazív) E. coli törzs, amely képes colonizálni az intestinalis mucosát és behatolni, illetve replikálódni az intestinalis epithel sejtekben. A genom mérete 4 773 108 bp, 4376 fehérjét tartalmaz.

Az E. coli O83:H1 szerotípusú NRG 857C törzs, a genom mérete 4 747 819 bp, 4582 fehérjét tartalmaz és egy pO83 CORR lineáris plazmidot, amely 147 060 bp.

Az E. coli UM 146 szintén adherens, invazív, amely ileális lokalizációjú Crohn betegséggel társul, a genom mérete 4 993 013 bp, 4783 proteint és egy nagy méretű pUN146 114 550 bp méretű circularis plazmidot tartalmaz.

Az NCBI adatbázisban számos hasmenéssel társuló E. coli törzs genomiális adatai szerepelnek. Ezek közé tartozik az E. coli 55989 (rokonságot mutat a németországi járványt okozó  O104:H4 törzzsel), klinikailag enteroaggregatív izolátum, 5 154 862 bp, 4767 gént és 4763 fehérjét kódol. Az E coli E2 4377A ETEC enterotoxigén coli törzs, amely O139:H28 szerotípusú, colonizációs faktor antigéneket (CFA) tartalmaz, köztük két pílus típusú coli surface antigént, a CS1 és CS3 típusokat, hő stabil és hő labilis enterotoxinokat, valamint több nem kellően jellemzett plazmidot. A komplett genom méret 4 979 619 bp, 4991 gén és 4997 fehérje, 6 plazmidja van, ezek a következők: pETEC5 5033 bp, pETEC74 74 224 bp, pETEC6 6199 bp, pETEC73 70 609 bp, pETEC 35 34 367 bp, pETEC80 79 237 bp.

Szintén enterotoxigén ETEC törzs az E coli ETEC H10407, amelynek genom mérete 5 153 435 bp, 4875 fehérjét és 4 plazmidot tartalmaz, a p948: 94 797 bp, a p666: 66 681 bp, a p58: 5800 bp, a p52: 5175 bp.

Az enterohaemorrhagias coli törzsek közül a következők genom adatai ismertek.

O153:H2 12009: 5 449 314 bp, 5121 gén, 5121 fehérje, valamint a pO103 plazmid 75 546 bp.

Az E. coli O111:H-  11128 EHEC törzs 5 371 077 bp, 5407 gén, 5407 protein, és 5 plazmid, a pO1115: 6673 bp, a pO1114: 8140 bp, pO1113: 77 690 bp, pO1112: 97 897 bp, pO1111: 204 604 bp.

Az O126:H11 11368 EHEC törzs,  5 697 240 bp, 5519 gén, 5519 ferhérje és 4 plazmid, pO264: 4073 bp, pO263: 5686 bp, pO262: 63 365 bp, pO261: 85 167 bp.

Az E. coli O55:H7 (németországi csecsemők hasmenéséből került izolálásra 2003-ban), érdekessége, hogy a multi-locus szekvencia tipizálás alapján egy O157:H7 klónnal bizonyult azonosnak, az ST11-vel (ST sequence type), 5 386 352 bp, 5121 gén, 5121 fehérje és egy plazmid pO55: 66 001 bp.

Az E coli O157:H7 TW14359 (2006, spenót volt a közvetítő) EHEC törzs (5 528 136 bp, 5365 gén és 5373 fehérje, valamint a pO157 plazmid: 94 601 bp).

A fent ismertetett törzsek nukleinsav szekvenciája, a gének és a fehérjék sorrendje, a grafikus ábrázolásuk megtekinthető az NCBI honlapján a prokaryoták részben az egyes E. coli törzsekre kattintva, a FASTA illetve a GRAFIC címszavak alatt.

Fontosabb adatbázisok az E. coli génjeivel, fehérjéivel kapcsolatban: EcoGene, ECOR/DEC

EPD (E. coli protease database), GenoBase K-12 W3110, GenProtEC, Gnom, ERIC, ASAP, BIGS, BRS, CGSC, Colibri, CyberCell, ECCE, ECDC, Echo/coliBase, EcoCyc, KEGG, PEC, Phydbac, PMTG, RegulonDB, STEC, TFBS, Transcription Factors, Osaka Univ., E. coli Wiki, E. coli GenExp, Sanger, U. Wisc, EcoliHUBOrganism Isolate Source of strain Species or Environmental Site Reference/Original Contact

A Broad Institute E. coli adatbázisában a következő izolátumok szekvenciája szerepel www.broadinstitute.org

The Eli and Edythe L. Broad Institute of Harvard and MIT (Massachusetts Institute of Technology)

E. coli B088 madár Circus assimilis David Gordon

E. coli B185 madár Turdus merula David Gordon

E. coli B354 madár Monarcha trivirgatus David Gordon

E. coli FVEC 1302 human Homo sapiens James Johnson

E. coli FVEC 1412 human Homo sapiens James Johnson

E. coli H299 human Homo sapiens David Gordon

E. coli H591 human Homo sapiens David Gordon

E. coli H736 human Homo sapiens David Gordon

E. coli M605 emlős Nyctophilus geoffroyi David Gordon

E. coli M718 emlős Sarcophilus harrisii David Gordon

E. coli TA143 emlős Antechinus bellus David Gordon

E. coli TA206 emlős Perameles nasuta David Gordon

E. coli TA271 emlős Dasyurus viverrinus David Gordon

E. coli TA280 emlős Dasyurus viverrinus David Gordon

E. coli H001 human Homo sapiens David Gordon

E. coli E560 környezeti Huon Creek, Albury, NSW David Gordon

E. coli TA014 emlős Potorous tridactylus David Gordon

E. coli H223 human Homo sapiens David Gordon

E. coli E1002 környezeti Lake Ginnderra, ACT, Australia David Gordon

E. coli B921 madár Anas superciliosa David Gordon

E. albertii B156 madár Australia David Gordon

E. coli FVEC 1465 human Homo sapiens James Johnson

E. coli TA255 emlős Dasyurus hallucatus David Gordon

E. coli R527 kétéltű Heteronotia binoei David Gordon

E. coli M056 emlős Antechinus flavipes David Gordon

E. coli H617 human Homo sapiens David Gordon

E. coli H588 human Homo sapiens David Gordon

E. coli H413 human Homo sapiens David Gordon

E. coli E1114 környezeti Lake Ginnderra, ACT, Australia David Gordon

E. coli TA144 emlős Dasyurus hallucatus David Gordon

E. coli B574 madár Lichenostomus penicillattus David Gordon

E. coli E267 környezeti Lake Burley Griffin, ACT, Australia David Gordon

E. coli B108 madár Philemon citreogularis David Gordon

E. coli B671 madár Grallina cyanoleuca David Gordon

E. coli H378 human Homo sapiens David Gordon

E. coli B367 madár Gymnorhina tibicen David Gordon

E. coli TA447 emlős Bettongia lesueur David Gordon

E. coli H386 human Homo sapiens David Gordon

E. coli H296 human Homo sapiens David Gordon

E. coli H305 human Homo sapiens David Gordon

E. coli B175 madár Trichoglossus haematodus David Gordon

E. coli E1118 környezeti Lake Burley Griffin, ACT, Australia David Gordon

E. coli H420 human Homo sapiens David Gordon

E. coli TA249 emlős Dasyurus hallucatus David Gordon

E. coli H454 human Homo sapiens David Gordon

E. coli T426 hal Scortum barcoo David Gordon

E. coli E704 környezetiWarragmaba Dam, NSW, Australia David Gordon

E. coli H605 human Homo sapiens David Gordon

E. coli TA054 emlős Isoodon obesulus David Gordon

E. coli TA008 emlős Sarcophilus harrisii David Gordon

E. coli H461 human Homo sapiens David Gordon

E. coli H383 human Homo sapiens David Gordon

E. coli TA464 emlős Macropus robustus David Gordon

E. coli B093 madár Strepera graculina David Gordon

E. coli E101 környezeti Lake Ginnderra, ACT, Australia David Gordon

E. coli H397 human Homo sapiens David Gordon

E. coli M114 emlős Nyctophilus geoffroyi David Gordon

A Broad Institute 13 németországi járványból számazó E. coli O104:H4 törzs szekvencia adatait közölte az NCBI adatbázisban.

A melegvérű állatok és az ember vastagbelében a mikrobiota (a bélflóra bakteriális biomassza) kevesebb mint 1 %-a, általában 0,1 % az E. coli törzs. Az E. coli flóra a bélben folyamatos változáson megy keresztül. Jelenleg az az általános álláspont, hogy az emberi vastagbélben a populáció 52,1%-ban egy, 34,9%-ban kettő, 4,4%-ban három, 0,6%-ban négy szerotípus van jelen. Az új szerotípusok a bélbe a szájon át kerülnek be. Az antibiotikum rezisztencia faktorokat (R –rezisztencia faktorok) vizsgálva a vegetáriánusok, a csecsemők és a nem vegetáriánusok között azt találták, hogy a mindenevőkben az R faktor tartalmú E. coli-k incidenciája nem magasabb, mint a vegetáriánusokban és a csecsemők bélrendszerében több rezisztens E. coli törzs volt jelen, mint a nem vegetáriánusokéban. Az előzetes várakozás az volt, hogy az állati termékeket fogyasztók között lesz a legnagyobb előfordulási arányú a rezisztens coli törzsek száma a növekedést elősegítő antimikrobiális szerek kiterjedt használata miatt. Az említett megfigyelés magyarázata nem ismert. Leírták azt is, hogy a lakatlan Krakatoa szigetvilágban jelen voltak antibiotikum rezisztencia plazmidokat tartalmazó E. coli törzsek, a helyi növényzeten.

Az előzőekben leírt megfigyelések szerint az emberi populáció jelentős részében egy E. coli törzsnél több van jelen a bélrendszerben, és a bélben lévő törzsek évente három-négy alkalommal változnak.

Az E.coli törzsek tipizálása antigén struktúrájuk alapján történik. Az O a szomatikus antigént, a H a flagelláris antigént (Haut), a K a kapszuláris (tok) antigént jelöli. Az összes kombinációt számba véve több mint 700 E. coli antigén típus (szerotípus) különíthető el.

A pathogén E. coli törzsek emberben háromféle infekciót okoznak, vizeletelvezető rendszer fertőzéseket (UTI, urinary tract infection), neonatalis meningitist és intestinalis (gastroenteritis) megbetegedést. Azt, hogy egy E. coli törzs kórokozó-e, vagy nem, a virulencia determinánsai határozzák meg. Ezek lehetnek adhesinek, invasinok, toxinok, és a gazdaszervezet védekező rendszerével szembeni ellenállást biztosító baktriális tényezők.

Összefoglalóan ilyen virulencia tényezők következők: adhesinek- CFA1/CFA2, 1-es típusú fimbriák, p fimbriák, S fimbriák, intimin (non-fimbriális adhesin) és EPEC (enteropatogenic Escherichia coli) adherencia faktor, invasinok- haemolysin, Shigella szerű invasinok, motilitást, kemotaxist meghatározó tényezők, csillók, toxinok- LT (hőlabilis toxin), ST (hőstabil toxin), Shiga-toxin (verotoxin) és Shiga-szerű toxin, citotoxinok, endotoxin (LPS).

Antifagocyta felszíni tényezők- a tok, a K antigének, LPS, és az antigén variációk, genetikai tényezők- a gének cseréje transzdukcióval és konjugációval, transzmisszibilis plazmidok, E faktorok és bróm rezisztencia plazmidok, toxin és más virulencia plazmidok, siderophorok és siderophor felvevő rendszerek és a patogenitási szigetek.

Az E. coli baktériumok az újszülött gastrointestinalis traktusát a születés után mintegy 40 órán belül colonizálják. Az újszülöttbe a baktériumok az ellátó személyekről, az élelmiszerekből, vízből kerülnek. A baktériumok a vastagbél nyákrétegéhez tapadnak. Az emberi gastrointestinális traktusban található E. coli baktériumok fakultatív anaerobok (képesek növekedni oxigén jelenlétében és annak hiányában is). Amíg a baktériumok nem akvirálnak virulencia faktorokat, addig kommenzálisak maradnak. A virulencia fehérjék génjei jelen lehetnek extrakromoszómális plazmidokon, bakteriofágokban és sajátos, pathogenicitási szigeteknek (PAI, pathogenicity islands) nevezett kromoszómális területeken. A PAI horizontális géntranszferrel kerülhet az E. coli baktériumba, és a kromoszómába plazmid vagy bakteriofág integrálódása vagy transzpoziciója révén juthat. Az E. coli baktérium törzseket felhasználták a biotechnológiai és ipari mikrobiológiai laboratóriumi folyamatokban ipari fermentáció, rekombináns proteinek, rekombináns DNS technológiák, enzimek, vakcinák gyártására. A baktérium a mikrobiológiai kutatások egyik modell élőlénye. 1946-ban Lederberg és Tatum a coli baktériumon írta le a bakteriális konjugációt, 1958-ban élettani-orvosi Nobel díjat kaptak George Beadle-vel közösen. Benzer E. coli baktériumon tanulmányozta a bakteriofág T4 genetikai folyamatait. Az első E. coli gént Jonathan Beckwith izolálta 1969-ben. Az E. coli K12 egyike volt az elsőorganizmusoknak, amelynek teljes genomiális szekvenciáját feltérképezték (F. Blattner, 1997).

  

    Joshua Lederberg             Edward Lawrie Tatum           George Wells Beadle

            1925-2008                              1909-1975                               1903-1989

Nobel díj: élettani-orvosi, 1958.

Seymour Benzer

1921-2007

Albert Lasker Award for Basic Medical Research, 1971.

Jonathan Roger Beckwith(1935-)

Selman A. Waksman Award in Microbiology, 2009.

A képek forrása: Internet

Az E. coli által okozott kórképek

A virulens coli törzsek okozhatnak intestinalis, húgyúti (UPEC), neonatalis infekciót, neonatalis meningitist (NMEC, vagy MENEC), meningitis infekciókat, ritkább esetekben HUS-t. Kórokozóként szerepelhetnek peritonitisben, mastitisben, szepszisben, bőr és lágyrész fertőzésekben, pneumoniában.

Az E. coli törzsek által okozott gastrointestinalis infekciók

Már Theodor Escherich felvetette az E. coli intestinalis pathogén szerepét. Általában hat pathotípus (virotípus) szerepel a hasmenéssel járó kórképek (diarrhoegenic E coli, DEC) klinikai leírása során, minden egyes pathotípus különböző klinikai képet eredményez és adott szerológiai alcsoportokhoz tartozik.

Ezek a következők: ETEC enterotoxigén E. coli

EIEC enteroinvaziv E. coli

EHEC enterohaemorrhagias E. coli

EPEC enteropathogen E. coli

EAEC anteroaggregativ E. coli

DAEC diffusan adherens E. coli

Az enterális kórokozó E. coli törzseket összefoglaló néven EEC, enterovirulens E. coli-ként is említik. Az EPEC törzsek néha DAEC, diffusan adherens E. coli néven kerülnek említésre. Az extraintestinális pathogén coli törzseket ExPECnek nevezik. Kevésbé ismertek a necrotoxigen E coli törzsek (NTEC), a sejt-leválást okozók (cell-detaching E. coli törzsek (CDEC) és az  adherens-invasív törzsek (adherent invasive E. coli, AIEC). A SEPEC szepszist kiváltó coli törzs.

E. coli törzsek állatokban is képesek betegséget okozni. Specifikus kórképek:

  • a szopós és az elválasztott malacok hasmenése, oedema betegsége
  • a kecskegidák és bárányok szepszise
  • a szárnyasok szepszise
  • a tehenek tőgy gyulladása

Leggyakrabban az E. coli baktérium tehető felelőssé a kutyák és a macskák garatában és környékén lezajló kóros folyamatokért.

Az egyes pathogén tulajdonsággal rendelkező törzsek virulencia faktorai és pathogén mechanizmusai

(Nataro JP, Kaper JB.Diarrheagenic Escherichia coli. Clin Microbiol Rev 1998, 11, 142-203, Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity, Nat Rev Microbiol 2010, 8, 26-38, az E. coli virulencia faktorok genetikai jellemzői az NCBI, Genecards, Uniprot, KEGG. VFDB:Virulence factorsof bacterialpathogens, www.mgc.ac.cn/VFs/main.htm és EcoliWiki, WikiGenes adatbázisok alapján készültek).

 

           James P. Nataro      James B. Kaper        Matthew A. Croxen        B. Brett Finlay

(a közlemények szerzői) A képek forrása: Internet

DAEC: jellegzetes diffúz adherencia mintázatuk van HEp-2 sejteken. Az enterocytákon megnyúlt microvillusokhoz tapadnak.  Két fontosabb alosztálya létezik a DA-EPEC (diffuse adherent enteropathogenic E. coli), amely az LEE patogén szigetet tartalmazza (részletesen ld. később) és a DAEC, amely az Afa/DR adhezincsaládot tartalmazza.

Diffuzan adherens E. coli (DAEC) pathomechanizmusa és virulencia tényezői

A DAEC heterogén csoport, amely a HeLa (méhnyakrák immortális sejtvonal, az első sejtvonal, 1951-ben Georg Otto Gey készítette, elnevezése a beteg után /Henrietta Lacks/ történt) és a HEp2 (1952-ban A. E. Moore, L. Sabachewsky, és H. W. Toolan alakitotta ki /Cancer Res 1955, 15, 598/ human larynx epidermoid  carcinoma sejtvonalból, emberi izoláció után irradiált, steroid kezelt, szopós patkányba inocculált sejtek voltak, az eredeti vonal HeLa kontaminált volt)sejtek felszínén diffúz adherencia mintázatot mutat. A mintázatot fimbriális (Dr- Dr vércsoport antigén kötő), és F1845 afimbriális (AFA) adhezinek, kollektiv jelölésük AFA-Dr adhezinek, hozzák létre. Az adhezineket expresszáló DAEC izolátumok a vékonybelet colonizálják és általában csecsemő, kisgyermekkori, 18 hónaptól 5 évig terjedő korosztályban okoznak hasmenést, valamint felnőttekben recurráló húgyúti fertőzéseket. Az AFA-Dr adhezinek kapcsolatba lépnek a vékonybél enterocyták kefeszegélyével asszociált komplement decay accelerating factorral (DAF) és az uroepithel sejteken található DAF molekulákkal (CD55 molecule, decay accelerating factor for complement, Cromer blood group, komplement cascade reguláló membrán fehérje, C4b és C3b fehérjéket ismer fel, és gátolja a C2 és B faktor konverzióját, a C4bC2a illetve C3bBb amplifikációs konvertázok kialakulását. 1q32, 38 983 bp, 381 aa, 41 400 Da, 38 protein kapcsolat, 21 332 SNP, single nucleotid polymorphism). A kapcsolódás a DAF molekulák aggregációját okozza, amely Ca++ dependens jelutakat aktivál, és ennek következtében az érintett microvillusok elongációja és károsodása jön létre a citoszkeleton komponenseinek dysorganizációja következtében. Az adhezió hatására a DAF IL-8 szekréciót indukál az enterocytákban, ami következményesen elősegíti a granulocyták transmigrációját a mucosalis epithel rétegen keresztül. A szekréció tovább növeli a DAF expressziót, ellátván a sejtek felszínét még több kötőhellyel (circulus vitiosus folyamat). A DAEC az AFA-Dr adhezineken keresztül kapcsolatba lép a PMN sejtekkel is, és elindítja a sejtek apoptozisát, csökkentve ezzel a baktériumok elleni fagocyta aktivitást. Az AFA-Dr fimbriák egy alosztálya kapcsolódik a CEACAM (carcinoembrionic antigen-related cell-adhesion molecule) receptor család tagjaihoz, amelyek a sejtek membránjának lipid tutajaiban helyezkednek el.

A CEACAM-okkal való interakció fokozza a Cdc42 (cell division cycle 42 protein) aktivációját, ami a CEACAM-ok aggregációjához vezet a tapadó baktériumok területén és a kefeszegély microvillusainak lecsupaszodását (effacement) okozza. Ezzel a kefeszegély enzimei károsodnak, ami a bél szekréciós és abszorpciós folyamatait rontja, és hasmenéshez vezet. Az AFA-Dr adhezin interakció a CEACAM-val és a DAF-val kiváltja a DAEC mikrotubulus dependens felvételét az enterocytákba, ahol a baktériumok képesek a vacuolumokban túlélni. Úgy tűnik, hogy a többi E. coli pathogénhez viszonyítva a DAEC pathogenezisében a legfontosabb az AFA-Dr adhezin interakció a gazdasejtekkel. A Sat szekretált autotranszporter toxin (Sat secreted autoranspoter toxin) fontos pathogenetikai tényező a tight junction károsításában és a permeábilitás fokozódásban. Más szekréciós rendszer, vagy virulencia faktor nem volt található az AFA-Dr pozitív DAEC izolátumokban.

Az Afa/Dr DAEC törzsek hasmenést okozó tulajdonsága nem egyértelmű. Felnőtt önkéntesek közül csak egyben alakult ki diarrhoeae, bár a duodenumból és a székletből a baktériumok jelenléte igazolható volt. Gyerekek esetében valószínűsítették a DAEC törzsek hasmenést okozó sajátságát. Sporadikus, vízszerű hasmenésben szenvedő hospitalizált betegekben szintén megfigyelték a DAEC csoporthoz tartozó coli törzsek jelenlétét.

A DAEC törzsek fő virulencia faktora az Afa/Dr adherencia rendszer. Ennek a tagjai az AfaE-I, AfaE-III, Tr-II, fimbriális Dr, és az F1845 adhezinek. Az Afa/Dr rendszer receptora (részleteket lásd a virulencia faktoroknál) a DAF (decay-accelerating factor, CD55), a sejtek felszínén glikozil foszfatidil inozitol horgonnyal rögzült protein, és gátolja a sejtek komplement aktivációjából eredő károsodást. A harmadik rövid konszenzus ismétlődés (SCR-short consensus repeate) domain szolgál az adhezinek kötőhelyéül. A carcionoembrionicus antigén (CEA) az adhezinek másik kötőhelye. A CEA CAM (cell adhesion molecule) szintén GPI horgonnyal a membránhoz rögzült molekula. A CEA, illetve az ezzel rokon szerkezetű adhézios molekulák a CEACAM családhoz tartoznak, amelyek az adhéziós molekulák immunglobulin szupercsaládjának tagjai. A CEACAM 1, 3, 4 carboxy terminális transzmembrán és citoplazmikus domainekkel is rendelkezik, a CEACAM 5, 6, 7, 8 GPI horgonnyal rögzül a membránhoz. Valamennyi CEACAM az immunglobulin szupercsaládba, a CEA /carcinoembrionikus antigén/ alcsaládba tartozik, sejtadhéziós molekulák, homofil és heterofil interakciókat létesítva szerepet játszanak a differenciálódásban, három dimenziós szöveti felépülésben, angiogenezisben, apoptózis szabályozásban. A család tagjai a következők: CEACAM1, CEACAM16, CEACAM18 CEACAM19, CEACAM20, CEACAM21, CEACAM22P, CEACAM3, CEACAM4, CEACAM5, CEACAM6, CEACAM7, CEACAM8, CEACAMP1 (carcinoembryonic antigen-related cell adhesion molecule pseudogene 1, p pseudogene), CEACAMP10, CEACAMP11, CEACAMP2, CEACAMP3, CEACAMP4, CEACAMP5, CEACAMP6, CEACAMP7, CEACAMP8, CEACAMP9.

CEACAM 1, carcinoembryonic antigen-related cell adhesion molecule 1 biliary glycoprotein, CD66a, valamennyi CEACAM az immunglobulin szupercsaládba, a CEA /carcinoembrionikus antigén/ alcsaládba tartozik, sejtadhéziós molekulák, homofil és heterofil interakciókat létesítva szerepet játszanak a differenciálódásban, három dimenziós szöveti felépülésben, angiogenezisben, apoptózis szabályozásban. 19q13.2, 21 204 bp, 526 AA, 57 560 Da, 11 alternatív splice protein isoform, 16 fehérje kapcsolat, 29 SNP.

CEACAM16, carcinoembryonic antigen-related cell adhesion molecule 16, 19q13.32, 11 566 bp, 484 AA, 52681 Da, 199 SNP.

CEACAM18, carcinoembryonic antigen-related cell adhesion molecule 18, 19q13.41, 8 522 bp, 398 AA, 44060 Da, 159 SNP.

CEACAM19, carcinoembryonic antigen-related cell adhesion molecule 19, 19q13.31, 12 908 bp, 300 AA, 32638 Da, 226 SNP.

CEACAM20, carcinoembryonic antigen-related cell adhesion molecule 20, 19q13.31, 28 083 bp, 585 AA, 64502 Da, 451 SNP.

CEACAM21, carcinoembryonic antigen-related cell adhesion molecule 21, 19q13.2, 51 496 bp, 293 AA, 32373 Da, 183 SNP.

CEACAM22p, carcinoembryonic antigen-related cell adhesion molecule 2, pseudogene, 19q13.31, 83 075 bp.

CEACAM3, CEA, carcinoembryonic antigen-related cell adhesion molecule 3, CD66d, transmembrán protein, egyes CEACAM kötő baktériumok Rac1 dependens, granulocyta mediált, nem opszonin függő fagocitózisában szerepel. A veleszületett immunrendszer tagja, a Neissiria, Moxarella, Haemophilus sp-kfagocitózisát mediálja. 19q13.2, 15984 bp, 252 AA, 27 091 Da, 5 fehérje kapcsolat, 237 SNP.

CEACAM4, carcinoembryonic antigen-related cell adhesion molecule 4, 19q13.2, 8 099 bp, 244 AA, 25909 Da, 194 SNP.  

CEACAM5, CEA, carcinoembryonic antigen-related cell adhesion molecule 5, CD66e, sejtfelszíni glikoprotein, homodimer, a sejtmembránhoz GPI horgonnyal rögzített. Az E.coli Dr adhesinek receptora. Az E.coli Dr adhesinek kapcsolódása a homodimer disszociációját okozza. 19q13.1-q13.2, 21934 bp, 702 AA, 76795 Da, 5 protein asszociáció, 395 SNP.

CEACAM6, CEAL, carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross, CD66c. A CEA a carcinomák elterjedt, szérumban kimutatható, neoplasticus markere. 19q13.1-q13.2, 16785 bp, 344 aa, 37 195 Da, 2 fehérje kapcsolat, 261 SNP.

CEACAM7, CEA, carcinoembryonic antigen-related cell adhesion molecule 7, 19q13.2, 15 062 bp, 295 AA, 29 379 Da, 286 SNP .

CEACAM8, carcinoembryonic antigen-related cell adhesion molecule 8, CD67, CD66b, 19q13.2, 14 690 bp, 349 AA, 38 154 Da, 3 protein kapcsolat, 218 SNP.

A CEACAMP1, CEACAMP10, CEACAMP11, CEACAMP2, CEACAMP3, CEACAMP4, CEACAMP5, CEACAMP6, CEACAMP7, CEACAMP8, CEACAMP9 a 19q13 régió területén lévő különböző méretű pszeudogének (az egyes gének adatai a genecards adatbázisból származnak, www.genecards.org).

A jellemző citopátiás effektus az adheziót követően egy hosszú cellularis kitüremkedés, amely körbe burkolja a baktériumot. Minden Dr családtag előidézi ezt a változást, és ez megfigyelhető az UPEC törzsek esetén is. A Dr adhezinek kötődése ezekhez a sejtfelszíni struktúrákhoz több jelátviteli utat indít el a sejtekben, többek között a foszfatidil-inozitol 3 kináz aktiválódását (PI3K).

EAEC törzsek pathomechanizmusa

 EAEC perzisztáló hasmenést okoz fiatal gyermekekben, gyulladás, láz nélkül, stabil toxin- szerű toxint és hemolizint termel. A törzs nem invazív és az adhezinjeit teljes mértékben még nem karakterizálták.

Jellegzetes téglarakás-szerű (autoagglutináció) aggregatív (AA, aggregative adherence) tapadási mintázatuk van HEp-2 sejteken. Nem szekretálnak sem hőlabilis, sem hőstabil enterotoxint (mint az enterotoxigén, ETEC törzsek). Heterogének, de a törzsek többsége tartalmaz virulencia plazmidot. Adherencia faktoraik: Aaf-ek és dispersin. Toxinjaik: EAST1, Pet, Pic és ShET1 (l. később).

Az AAF fimbriák (aggregative adherence fimbriae) közvetítik az EAEC törzsek kezdeti tapadását az intestinális mucosához. A baktériumok kolonizációja fokozott mucustermeléssel és következményesen vastag nyákréteg képződésével jár, amelynek védett környezetében a baktériumok beágyazódva perzisztálnak.

Az EAEC a legkésőbb, 1987-ben leírt EEC törzs, JP Nataro azonosította Chilében egy gyermek perzisztens hasmenése során 2005-ben.

Az EAEC-t jelenleg emerging pathogénnek (új kórokozónak) tartják. Az ETEC törzsek után a fejlődő és a fejlett országokban a második leggyakoribb oka az utazók hasmenésének. Az EAEC törzseket egyre gyakrabban találják meg endémiás és epidémiás hasmenéses esetek kórokozójaként. Okozott járványokat Europában, UK-ban, Svájban és Japánban.

Kórokozóként szerepel továbbá gyermekek (alultáplált állapotú gyermekekben a fejlődő országokban az akut hasmenések 15 %-ában, fejlett országokban a hasmenések 4 %-ában) és HIV fertőzöttek hasmenésében, a fejlődő és a fejlett országokban egyaránt. Az EAEC 042 törzs önkénteseken 10 milliárd cfu (colony forming unit) inoculumban való jelenléte esetén váltott ki hasmenést. A nagy dózis alapján étel vagy víz közvetítő szerepe valószínűsíthető.

A mexikói ételízesítő szószok 43 %-ban találtak EAEC törzseket (az USA-ban 0%-ban). Az USA-ban hasmenés miatt ambulanciákra és kórházba került gyermekek és felnőttek között az EAEC előfordulás mintegy 4.5 %.

Az EAEC által okozott hasmenés többnyire vízszerű, de lehet nyákos és véres is.

Az EAEC infekciók legfontosabb tünetei a következők: vízszerű hasmenés 76%-ban, hasi fájdalom, hasi görcsök 45,5%-ban, hányinger, hányás 41-64,5%-ban, 38,5C feletti láz 18-19,8%-ban.

A széklet jellemzői a következők: véres hasmenés 3,3-31,1%-ban, nyákos hasmenés 4,1-55,2%-ban, gennyes hasmenés 28,9%-ban.

Az EAEC rendszerint magától megszűnő, szájon át történő rehidrációra jól reagáló kórkép.  Néhány tanulmányban rezisztensnek bizonyult ampicillinre, tetracyclinre, chloramphenicolra, trimetroprimra, sulfomethoxasole-ra.

A rezisztenciát a rezisztencia integronon kódolt dfrA5, aadA1A, drA13, oxa5 génclusternek tulajdonították.

A világ legtöbb régiójában az EAEC törzsek érzékenynek bizonyultak fluorokinolon, azithromycin, rifaximin, amoxicillin/clavulansav, nalidixsav kezelésre.

Az EAEC kezelésében klinikai vizsgálatokban értékelték a ciprofloxacin és a rifaximin hatását: 2x500 mg ciprofloxacin 3 napig, 200 vagy 400mg rifaximin 2x naponta 3 napig. A ciprofloxacinnal kezelt csoportban a kezelést követően a placebo csoporthoz képest a hasmenés időtartama 56 óráról 36 órára rövidült, a második csoportban szintén szignifikáns rövidülés volt megfigyelhető a hasmenés időtartamában, 72 óráról 22 órára csökkent a hasmenéses időszak. Megjegyzendő azonban, hogy a Shiga toxint akvirált EAEC törzseknél az EHEC törzsekhez hasonlóan végzetes következményekkel járhat az antibiotikus kezelés a toxintermelő képesség fokozódása miatt. Ezt a németországi járvány során végzett in vitro vizsgálat alátámasztotta. Az STX RNS indukciója 83-szorosra nőtt ciprofloxacin hatására. Megjegyezhető még, hogy a véres széklet jelenléte klinikailag nem egyértelmű jele az EHEC kórokozó jelenlétének, mert mint az előzőekben említettük, az EAEC törzsek okozta hasmenések több mint 30%-a járt véres széklettel.

Fordítva is diagnosztikus nehézséget jelent, hogy az EHEC megbetegedések esetén a széklet nem szükségszerűen véres, ennek következtében a nem véres hasmenés esetében alkalmazott antibitotikus kezelés mind az EHEC, mind az EAEC törzsek esetén a toxin jelenlétében a klinikai helyzetet rontani fogja.

Az EAEC törzsek O antigénje tetrasaccharid ismétlődő egységekből épül fel és a törzsek különböző szerocsoportokhoz tartozhatnak. Ezek közül a leggyakoribbak az O44, O55, O86, O111, O125, O126, és O128.

A szerzők egyetértenek abban, hogy az EAEC törzsek nagy genetikai diverzitást mutatnak és igen heterogén kórokozó törzsnek tekinthetők.

A virulencia faktorok közül a 60 MD-s pAA plazmidon (p plasmid, AA aggregative adherence) kódolt fimbriális adherencia faktorok közül a német járványban talált AAF/I ritkának számít. Az AAF/I-t kódoló régió két clusterből áll. Az első régió a fimbriális gének szintéziséhez és a fimbriák felépüléséhez szükséges (struktúrális alegységek aggA), a másik régió pedig AggR (regulator) transzkripcionális aktivátort tartalmazza. Az AAF/II fimbriális adhezin család az EAEC törzsek szintén csak kis %-ában van jelen. Ezt a fimbriális rendszert is két géncluster szabályozza. Az első régiót az aaFA (aggregative adherence fimbriae II) strukturális alegységei, az aafM és az aafD chaperon alkotják. A második régió őrző proteint - aafC, transzripcionális aktivátort - aggR, valamint a regulator működésének expresszióját szabályozó fis gént (factor for inversion stimulation) tartalmaz. Ez utóbbi génproduktum az aafD chaperonon keresztül szabályozza az AAF/II expressziót. A harmadik aggregatív adherencia fimbria, az AAF/III fordul elő a leggyakrabban az EAEC törzsek között, pl. HIV fertőzött betegekben a törzsek 40%-ban van jelen. Az AAF/III fimbriális rendszert kódoló agg-III géncluster szintén plazmidon található és rokonságot mutat az agg és aaf (AAF/I illetve AAF/II) géncsoportokkal.

Az EAEC törzsek szekretálnak egy 10,2 kD-os, tipikus szignál szekvenciát tartalmazó peptidet, az aap gén termékét. Az aap gén az aggR transzkripcionális aktivátor szabályozása alatt áll. Ezt a fehérjét aspU-nak, EAEC secreted protein U-nak nevezték. A fehérje nem kovalens kötödéssel rögzül a baktériumsejtek felszínén. A sejtből egy ABC transzporter komplex révén kerül ki a felszínre. A kódoló gén egy 5 génből álló clusterben (aat-PABCD) helyezkedik el. A későbbiekben a gén termékét dispersinnek nevezték és az EAEC törzsek különleges virulencia faktorának bizonyult.

A törzs képes colonizálni mind a vékony, mind a vastagbeleket, relatíve enyhe gyulladásos folyamat alakul ki a vastagbélben. Állatmodell hiányában az EAEC pathogenezisével és virulencia faktoraival kapcsolatos ismereteink hiányosak. A jellemző eltérés az aggregatív adhézió, ami a téglarakásszerű bakteriális adherencia mintázat a Hep2 sejteken. A mintázat kialakulásáért felelős gének a pAA (aggregatív adherencia) virulencia plazmidon helyezkednek el. A mintegy 100 kb (kilobasis) nagyságú plazmid kódolja az aggregatív adherencia fimbriák (AAF) biogeneziséhez szükséges géneket, amelyek rokonságban állnak a Dr adhezinek családjával. Az AAF közvetíti az EAEC intestinális mucosához történő adherenciáját. Az AAF és a flagellin mediálta adherencia IL-8 képződését indukálja, amely azután neutrofilek transzmigrációját okozza. Négy AAF variánst azonosítottak, az AAF1, 2, 3, és a Hda változatokat. Az AAF receptorai nem ismertek, de az AAF 2 képes kapcsolódni fibronectinnel (extracelluláris és szolubilis, testfolyadékokban jelenlévő adhéziós protein, sejtfelszíni receptorai egyes integrinek). A dispersin tartja távol a sejtfal negatív töltésű glikopolisaccharid struktúrájától a pozitív töltésű fimbriális AAF extenziókat. A dispersin elektrosztatikus interakcióba lép a lipopoliszachariddal és elfedi a struktúra negatív töltését, megakadályozva ezzel az AAF nyúlványok visszatapadását a baktériumsejt felszínére. A dispersin interakció segíti elő az EAEC törzsek szétterjedését a mucosalis felszínen, meggátolva az EAEC baktérium sejtek egymáshoz történő tapadását és egymással való aggregációját. Az EAEC biofilm emiatt különbözik a nem patogén E. coli biofilmektől. Az EAEC biofilm az enterociták felszínén egy vastag mucosus réteggel burkolva helyezkedik el. Az EAEC képes ezen a vastag mucosus rétegen átjutni, elsősorban a Pic (protein involved in intestinal colonization, SPATE, serin protease autotransporter) fehérje mucolitikus aktivitása révén. Plazmidon és kromoszómálisan kódolt gének termékei egyaránt résztvesznek a biofilm képződésben. Ezek közé tartozik a VI-os típusú szekréciós rendszer és a rendszeren keresztül szekretálódott fehérjék. Az EAEC törzsek szekretált citotoxinok révén okoznak mucosalis károsodást. Az egyes izolátumokban általában nincs jelen egyidejűleg az összes, EAEC törzsekben leírt toxin.

Az EAEC törzsek külsö membránjában lévő egyes fehérjék pl. a 38 kD-s külső membrán fehérje (omp, outer membrane protein) is a törzs jellemző virulencia faktorai közé tartozik. A 18 kD-s galaktózt kötő külső membrán protein szintén alapvető a baktérium kultúrában történő növekedéséhez. Az EAEC törzsek aggregatív plazmidjában azonosítottak egy 4,1 kD-os, az ETEC törzsek hőstabil toxinjához hasonló, 38 aminosavból álló, 4 ciszteint tartalmazó toxint (enteroaggregatív heat stable toxin 1, EAST1). Az EAST1 az EAEC törzsek kb 40%-ban van jelen, de hasonló arányban előfordul nem pathogén coli törzsekben is. Az EHEC törzsek között az EAST1 termelési arány ennél valamivel gyakoribb. Az EAEC törzsek hemolitikus aktivitású toxint is termelnek, amely hasonlóságot mutat az E. coli hemolizinekkel. Az EAEC törzsek adherencia plazmidja általában két, 108 illetve 116 kD-os, az Enterobacteriaceae törzsekre jellemző SPATE típusú (serin proteáz autotransporter, type V secretion system, a szekréciós rendszerek leírása később történik) toxikus proteint kódol. A SPATE-k két osztálya különíthető el, az epitheliális sejtekre citotoxikus hatású I. osztály (pet, sigA, espC, espP, sat) és a mucint hasító II. osztály (pic, sepA, Tsh).

Az EAEC törzsek által szekretált SPATE-k egyike a pet gén terméke, a Pet toxin (plasmid encoded enterotoxin). Ez 140 kD-s prekurzor proteinként szintetizálódik és az N és C terminális végen processzálódik a szekréció során, majd végül módosulás után 104 kD-os fehérjeként szekretálódik. In vitro vizsgálatokban a Pet fehérje hasította a pepszint, az emberi véralvadási V. faktort, az alfa és béta spektrint, és az alfa és béta fodrint. A Pet fő célpontja az alfa-fodrin (SPTAN1, spectrin alpha non-erythrocytic 1, alpha-fodrin, filamentosus citoszkeletális fehérje, 9q34.11, 81 076 bp, 2472 AA, 284539 Da, 864 protein interakció, 1201 SNP, www.genecards.org), amelynek dysrupciója az aktin citoszkeleton károsodásához és exfoliációhoz vezet. A Pet toxin klatrin alapú endocitozissal kerül a sejtbe és ott az endoplazmás retikulumon (ER-n) át jut el a cytosolba.

További szekretált proteinek a pic/set kromoszómális génterületen kódolt virulencia faktorok, egy 116 kD-s szekretált fehérje, a Pic, ami 146,5 kD-s prekurzorként termelődik és hasonlóan a Pet-hez processzálása során az N és C terminális része lehasad. Ez is egy SPATE típusú autotranszporter fehérje, amely mucináz aktivitású, hemagglutinációt okoz és elősegíti a baktériumok ellenállását a szérum toxikus hatásaival szemben. A pic gén szekvencia identikus a S. flexneri she génjével. A protein e tulajdonságok alapján kapta a protein involved in colonisation (Pic) nevet. A S. flexneriben a pic/set locus a SHI-I patogenicitási szigeten belül helyezkedik el.

Két másik shigella toxin, a shigella enterotoxin 1 (ShET1, Shigella enterotoxin 1) és az EAST1(EnteroAggregative heat-Stable Toxin 1, 4,1 kD) szintén szerepel az EAEC patogenezisében, szerepük azonban nem teljesen tisztázott. Az EAEC és a S. flexneri 2A törzsekben egyaránt jelen van az oligomer enterotoxin ShET1. Ez is a pic génen belül kódolódik, az ellenirányú DNS szálon. Az ShET1 egy 20 kD-on (kilodalton) méretű, katalitikus A alegységből (setA gén terméke, Shigella enterotoxin A gene) és öt 7 kD-s B alegységből (set B gén terméke) épül fel. A hatásmechanizmus nem pontosan ismert, de a cAMP és cGMP rendszeren keresztül a toxin hozzájárul az intestinalis folyadék szekréció fokozódásához.

Ezek mellett az EAEC törzsek rendelkeznek több vas felvételi rendszerrel is. A baktériumok a humán haemoglobin lebontásából és a heminből származó vasat képesek felvenni. A pic képes a haemoglobin hasítására is. Több azonosság mellett a S. flexneri és az EAEC törzsek egymástól különböző pathogén stratégiákkal is rendelkeznek.

A S. flexneri elsősorban vastagbél pathogén, de a betegség elején vékonybél érintettség is van. Invazív baktérium, jelentős gyulladásos colitist okoz. A shigellosis elején számos beteg esetében vízszerű prodromális fázis vezeti be a későbbi vastagbélgyulladást. Ez a vízszerű fázis a ShET1 toxicus hatásának lehet következménye, a korán fellépő vékonybél érintettség tüneteként. Az EAEC a distalis vékonybeleket és a colont érintő pathogén, nem invazív kórokozó. A vízszerű hasmenés szintén az ShET1 említett hatásával magyarázható. Az EAEC törzsek heterogén pathogenitásúak, alkalmanként leírtak közepes fokú gyulladásos enteritist is. A németországi, Shiga toxint termelő EAEC törzsekhez hasonló kórképeket korábban már észleltek Franciaországban, HUS-ban szenvedő betegek esetében. 1998-ban publikálták az EAEC, Shiga toxint termelő E. coli törzse(ke)t (Morabito S, Karch H, Mariani-Kurkdjian P, Schmidt H, Minelli F, Bingen E, Caprioli A. Enteroaggregative, Shiga Toxin-Producing Escherichia coli O111:H2 Associated with an Outbreak of Hemolytic-Uremic  Syndrome.  J Clin Microbiol 1998, 36,840-842). A szerzők nyolc beteget érintő HUS járványból származó O111:H2 törzseket (RD1-8) tanulmányoztak. A törzsek típusosan aggregatív Hep2 adhéziót mutattak és a Vero sejt citotoxicitási assay-ben és PCR vizsgálattal is kimutatható volt az stx2 termelés. A B toxin alegység szekvenciája 100%-ban azonosnak bizonyult az O157:H7 EDL 933 törzs stx2b génszekvenciájával. A törzsek két plazmidot tartalmaztak, 100 és 2 kb méretűeket. Az EAEC adherencia géncluster a nagy plazmidon volt jelen. Az stx2 gént pedig az EHEC törzsekhez, pl. EDL933-hoz hasonlóan kromoszómálisan, lambda fág reguláló gén régió mellett (p) találták meg. Az O111:H2 törzs nem volt indukálható infekciózus fág termelésére. Már 1998-ban hangúlyozták, hogy az stx termelő képesség és az enteroaggregatív adhéziós tulajdonság együttes előfordulása legalább olyan súlyos pathogén hatást hoz létre, mint a klasszikus EHEC fertőzés.

Az EAEC törzsek némelyike az intestinalis epithel sejtek invázióját mutatja in vitro körülmények között, jejunális és colon sejtkultúrákban (EAEC236 O111:H12).

Az Enterobacteriaceae törzsek is tartalmazzák a Yersinia pestisben azonosított kromoszómális pgm (pigmentation) lokuszt. A pgm lokusz két részből áll, a hms szegmentből (hemin storage) és a high patogenicity island (hpi) pathogén szigetből. Ez utóbbi szükséges a Yersiniák pathogenitásához. A területen belül két fő virulencia gén található, az irp1 és irp2 (iron- repressible high –molecular weight proteins, HMWP1,2), amelyek vas molekulák által gátolható nagy molekula tömegű fehérjék. Ezek szabályozzák a yersiniabactin (siderofor) gének működését (fyuA, psn). A fyuA (ferric yersiniabactin uptake) a yersiniabactin receptora, a psn gén (pesticin sensitivity) a pesticin (siderofor) génje. Az fyu protein valószínűleg receptorként szolgál e protein számára is. Az irp2 és fyuA szekvenciák az EAEC törzsek 80%-ban vannak jelen, ennél kisebb arányban találhatók meg az EIEC törzsekben (27%), és az EPEC és ETEC törzsekben (5%). Ez a pathogén sziget nincs jelen az EHEC törzsekben.

A vas reguláló géneket tartalmazó pathogén sziget eltávolítása a Yersinia pestis baktériumból a kórokozó attenuálódását eredményezi. Állatmodellben nem jön létre letális fertőzés. Vas adása azonban a pathogenitás fokozódását okozza, elhullást eredményez. Ebben az évben leírtak egy letális megbetegedést egy kutatón, aki az attenuált baktérium okozta letális szepszisben halt meg, laboratóriumi fertőzés következtében. Post mortem kiderült, hogy herediter haemochromatosisban szenvedett. A szervezet vastartalma nagyfokban megnőtt, ami a kórokozó pathogenitását helyreállította (Frank KM, Schneewind O, Shieh W-J. Investigation of a Researcher’s Death Due to Septicemic Plague.  NEJM 2011, 364, 26, 2563-2564,10.1056/NEJMc1100859, updated on June 30, 2011, at NEJM.org)-

Az EAEC törzsek fontosabb virulencia faktorait táblázatban szemléltetjük, a törzsek a németországi járvány kórokozójával nagyfokú molekuláris hasonlóságot mutatnak (Huang BD et al. J Med Microbiol 55, 1303-1311, 2006, alapján)

Szabályozó gén

aggR     az EAEC plazmid virulencia génjeinek fő regulátora az aggregativ adherencia faktorok és a fimbriák génjeinek expresszióját irányítja (AAF/I, AAF/II, dispersin protein, PheU lokusz pathogenicitási sziget génjei)

Fimbriák

aggA  AAF/I kódoló gén, vörösvértest hemagglutinációt okoz

aafA  AAF/II kódoló gén, a colon mucosa adherenciát segíti elő

agg3 AAF/III kódoló gén

Enterotoxinok

astA az enteroaggregativ hőstabil toxint kódoló gén, hasonló az E. coli STa enterotoxinhoz

petA 108 kDa molekulatömegű autotranszporter protein, hőlabilis enterotoxin és cytotoxin

Külső membrán fehérjék (OMP, outer membrane protein)

OMP  elősegíti az EAEC törzsek adherenciáját és a vörösvértestek agglutinációját

Dispersin transporter

aatA ABC transzport fehérjét kódol, amely a dispersin protein külső membránon történő transzportját végzi

Szekretált fehérjék

aap a10 kDa méretű dispersin kódoló génje. A fehérje elősegíti az EAEC törzsek diszperzióját a bél mucosa felszínén. Emberben erősen immunogénnek bizonyult.

pic 109 kDa molekula tömegű szerin proteáz autotransporter protein (SPATE). Az enzim zselatinbontó és mucináz aktivitású, valamint elősegíti a vörösvértestek hemagglutinációját.

Yersiniabactin rendszer

irp2 a yersiniabactin siderophor, a vasfelvételi rendszer proteinjét kódoló gén,

Lectin

Lectin A komplex szénhidrát, hasonlóságot mutat a choleratoxin kötő alegységéhez , morfológiai változást indít el HEp-2 sejtekben és elősegíti az ileumban a folyadék felhalmozódását.

EHEC törzsek patomechanizumsa

Az EHEC törzsek főként gyermekkori véres hasmenést, haemorrhagias colitist, intenzív gyulladásos választ, alkalmanként HUS előfordulását okozzák. Klinikailag általában nincs láz, jellemzők az abdominalis görcsök, a kezdeti vizes hasmenést követően véres hasmenés kialakulása. Shiga toxint termelnek, labilis és stabil toxint nem termelnek, közepesen invazívak, adhesinjeik fimbriák, amelyek nem kellően karakterizáltak.

A CDC B kategóriás potenciális, bioterrorizmusra alkalmas ágensként kategorizálja az E. coli O157:H7 törzset. Az O157:H7 biokémiailag különbözik a többi E. coli törzstől, nem sorbitol fermetáló, a sorbitol tartalmú MacConcay agaron fehér színű telepeket képez. A többi E. coli törzs sorbitol fermentáló, így a németországi járványt okozó O104:H4 törzs is. A sorbitol fermentáció miatt a táptalaj pH-ja savas lesz, így az indikátor a telepeket lilára festi. Az O157:H7 a táptalaj peptonját fermentálja, a pH lúgos, így a telep fehér marad.

Jellemző pathogén tényezőjük a LEE locus (locus of enterocyte effacement), és a Shiga toxint termelő képesség.

Adherencia faktoraik: ECP, Efa-1/Lifa, intimin, Paa, ToxB.

Vasfelvételi rendszer: Chu.

Protease: EspP, StcE.

Reguláló elem: Ler.

Szekréciós rendszer: TTSS Type III secretion system.

Toxinok: hemolysin, stx.

TTSS által transzlokált proteinek: Cif, EspA, EspB, EspD, EspF, EspG, EspH, Map, NleA/EspI, NleC, NleD, Tir (részletes leírásuk a virulencia faktorok fejezetben).

Enterohaemorrhagias E. coli EHEC pathovariánsok, az A/E pathogenitás mechanizmusa

Az EHEC törzsek legfontosabb rezervoirjai a szarvasmarhák, amelyek vastagbelében az igen infekciózus, A/E (attaching/ effacing, tapadó/ csupaszító) pathogen törzsek colonizálnak. Emberben a bélrendszerben a distalis ileum szakaszán és a vastagbélben kolonizálnak és a súlyos gastroenteritisek gyakori kórokozói a fejlett országokban. Az emberekre történő átvitel rendszerint kontaminált élelmiszer vagy víz közvetítésével történik. Észak-Amerikában, Japánban, valamint Európában a legtöbb EHEC kitörést az O157:H7 szerotípus okozta, de más szerotípusok is jelentenek egészségügyi kockázatot. Az EHEC fertőzésekben szenvedő felnőttekben és gyermekekben haemorrhagias colitis alakulhat ki és további komplikációként hemolitikus urémiás szindróma (HUS) fejlőhet ki. Szinte valamennyi EHEC törzs tartalmaz egy 92 kb méretű virulencia plazmidot, a pO157-t, amelyben 100 leolvasó keret (open reading frame, ORF) van jelen, és a plazmid több virulencia faktort kódol. Az EHEC törzsek egyik legfontosabb virulencia faktora a kromoszómán, inzertálódott fág génterületben kódolt Shiga toxin (STX) vagy verotoxin. Az STX toxin termelődésének képessége jellemzi a Shiga toxint termelő E. coli (STEC, ESTEC) csoportot, amelyek közé az O157:H7 is tartozik. Az EHEC izolátumokban az STX két alcsoportjának különféle kombinációban történő termelődése figyelhető meg (STX1 és 2). Haemorrhagias colitisben és HUS-ban az STX2 termelődés gyakoribb, mint az STX1 produkció. Az STX AB5 toxin, részletes leírását ld. később a toxinok részben. Az EHEC törzsekben nincs STX szekréciós mechanizmus, a toxin felszabadulása a lambdoid fág mediálta litikus hatás, vagy a DNS károsodásra adott SOS válasz, vagy az antibiotikus terápia hatására következik be. Az STX receptorok globotriosyl ceramid molekulák (GB3), amelyek az emberi intestinalis mucosában a Panett sejteken találhatók, és jelen vannak a vese epithel sejtek felszínén is. Szarvasmarhákban ezek a receptorok nincsenek jelen a gastrointestinalis traktusban, ami megmagyarázza az aszimptomatikus colonizációt. Az STX B alegységének GB3-hoz történő kötődése membrán invaginációhoz és így toxin internalizációjához vezet. Az internalizálódott STX toxin a Golgiban a korai endoszómákba kerül, ahol enzimatikus hasítás révén az A alegység proteolitikusan aktívvá válik, és N-glikozidáz aktivitása révén meggátolja a riboszómális protein szintézist. Végeredményben a sejtek halálát okozza.

Az STX toxin a GB3 kötőhellyel nem rendelkező humán intestinalis sejtekbe is képes makropinocytosis révén bekerülni. Ezekben a setekben az STX gátolja a protein szintézist, de nem idéz elő apoptozist, hanem a kemokin termelődést csökkenti és gátolja a gyulladásos válaszreakciót.

Az EHEC törzsek kezdeti tapadásának mechanizmusa a colonocitákhoz nem teljesen ismert. Az EHEC törzsekben 16 lehetséges fimbria operon van jelen, ezeket azonban még kiterjedtebben nem tanulmányozták. Újabban megfigyelték, hogy a IV-es típusú, ún. haemorrhagias coli pílusok (HCP) részvétele fontos a kezdeti adherencia és a biofilm kialakulásában. Ezek mellett a flagella és az E. coli közös pílus (E. coli common pilus, ECP) is részt vesz a gazdasejthez történő tapadásban. Ilyenkor a baktériumok pusztulása a fág litikus ciklusa, vagy baktericid antibiotikum hatására STX felszabadulással jár. A toxin receptoriális úton a Paneth sejteken keresztül a keringésbe jut, és a vesébe kerül, ahol a HUS kialakulásában szerepel. A colon epithel sejtek macropinocytosisa során a STX a sejtekbe kerül, ahol a nucleolin expresszióját fokozza, ami azután részt vesz a bektériumok szoros adherenciájának kialakításában.  Az EPEC-hez hasonlóan az EHEC törzsekben is a későbbi, gazdasejtekhez való közvetlen tapadást az intimin-TIR (translocated intimin receptor) interakció biztosítja. A TIR-en kívül az EHEC törzsek esetében a membránban expresszálódó nucleolin is receptorként szolgál az intimin számára.

Az EHEC genom ugyanolyan LEE génterületet tartalmaz, mint az EPEC genom, azonban az EHEC törzsek csaknem kétszer annyi effektor molekulát injektálnak a gazda sejtbe, mint az EPEC törzsek. Ezek legnagyobb része redundáns. Ez a redundancia evolúciós előnyt biztosít az EHEC törzsek számára a környezetben lévő baktérium törzsekkel szemben. Az intimin-TIR kapcsolat kialakulása után alapzat (pedestal, piadestal) épül fel a gazdasejtben. A törzsek adherenciáját követő alapzat kialakulásának mechanizmusa az EPEC és az EHEC törzsek esetében különbözik. Az EHEC törzsek alapzat felépülésekor a TIR molekulákon nem alakul ki tirozin foszforiláció a gazdasejtben és az alapzat felépülés nem NCK (non-catalytic region of tyrosine kinase adaptor protein 1) dependens folyamat. Az aktin citoszkeleton átalakulást egy EspF (E. coli secreted protein F) homológ molekula, a TIR cystosceleton coupling protein (TCCP vagy EspFU) indítja el, amely inzulin receptor tirozin kináz szubsztrát (IRTKS/insulin receptor tyrosine kinase substrate/) a BAIAP2L1 (Brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 1) fehérjével kapcsolódik. A protein egy inzulin receptor szubsztrát fehérje homológ adaptor (IRSp53, BAIAP2L1, inzulin receptor tirozin kináz szubsztrát fehérje, 7q22.1, 109 466 bp, 511 AA, 56 883 Da, 6 protein kapcsolat, 1598 SNP, www.genecards.org). Az aktin kötegek kialakulásában és a filopodium képződésben, valamint az aktin citiszkeleton átrendeződésben tölt be fontos szerepet. Kötődik a RAC1-hez (p21 rac1, ras-related C3 botulinum toxin substrate 1, rho kis GTP kötő, GTPase fehérje család tagja, 7p22.1, 29 483 bp, 192 AA, 21 450 Da, 410 fehérje kapcsolat, 676 SNP,www.genecards.org), és az F-actinhoz (béta actin, citoszkeletális fehérje, G globuláris monomer és F filamentosus helicalis polimer formájú, motilitásban résztvevő fehérje, 7p22.1, 36 637 bp, 375 AA, 41 737 Da, 176 SNP, www.genecards.org) SH3 domainen keresztül PXXP motivummal kapcsolódik az E coli EspF-szerű U profágon kódolt fehérjéjével. Kapcsolódik a TIR-vel is.

A TCCP (337 AA, Tir-cytoskeleton coupling protein) kapcsolódik az NWASP (neuronal Wiskott–Aldrich Syndrome protein, 7q31.3, 67 133 bp, 505 AA, 54 827 Da, 83 fehérje kapcsolat, 827 SNP) / ARP2,3 komplexhez (Acanthamoeba castellanii related protein, actin related protein 2/3 komplex, 34 kD alegység, 2q36.1, 37 263 bp, 300 AA, 34 333 kD, 102 protein kapcsolat, 528 SNP, www.genecards.org), és elindítja az aktin citoszkeleton átrendeződést. A nem O157 EHEC törzsek mind a kétféle, NCK dependens és independens alapzat felépülési mechanizmust alkalmazzák.

Az NCK 1,2 adaptor proteinek (non-catalytic region of tyrosine kinase adaptor protein), a membrán receptor tirozin kinázok aktivációja során a szignál átvitelben szereplő fehérjék, Src homológ 2,3 domaineket (SH) tartalmaznak (az NCK1 gén a 3q22.3 kromoszóma régióban helyezkedik el, a 136581050 bp és a 136668665 bp közötti pter /p terminális/ vég között, 87616 bp-t tartalmaz, transzkripciós faktoraik: AP1, c-jun, c-fos, FOXD1, Nkx6-1, FOXF2, SREBP-1A, 1B, 1C és GATA1, a fehérje 377 aminosavból áll, 41684 Da méretű, 291 protein interakciója, nyolc alternatív splice mintázata és 751 single nucleotid polimorfizmusa /SNP/ ismert az NCBI és GeneCards adatbázisokban, www.genecards.org).

Számos biológiai folyamatban vesz részt, a transzláció regulációjában, az aktin filamentumok organizációjában és polimerizációjában, szignalizációs komplex kialakításában, axon növekedés irányításában, sejtmigrációban, lammopodiumok felépülésében, a T sejt aktivációban, a T sejt receptor jelátvitelben és a T sejt proliferációban, DNS károsodásra adott válasz létrejöttében a CHEK 2 (CHK2 checkpoint homolog,  Schizosaccharomyces pombe checkpoint homolog fehérje, Chk1 és Chk2 serin/threonin kináz enzimek, a sejtciklus kontrollját végzik egy és kétszálú DNS károsodás érzékelésekor, a CHK2 22q12.1 kromoszómális lokalizációjú, 54 680 bp, 543 AA, 60 915 Da, 195 fehérje kapcsolat, 905 SNP,www.genecards.org) effektor fehérje aktiválása révén.

Az EHEC törzsekben működik továbbá a gazdaszervezetből származó egyes hormonok, a felszabaduló adrenalin és noradrenalin érzékelése is, valamint a gastrointestinalis sejtekből származó egyes molekulák detektálása, az ún. quorum sensing molecule autoinducer 3, AI3 révén, amely szabályozza a TTSS rendszer expresszióját. Ezeknek a stresszoroknak az érzékelő képessége és az erre történő reagálás az EHEC törzsek alapvető virulencia sajátossága.

 

Az A/E pathogének okozta hasmenés pathomechanizmusa jelenleg csak részben ismert. A Citrobacter rhodentium adta a lehetőséget természetes rágcsáló modellben az A/E patogének pathofiziológiai folyamatainak tanulmányozására. A TTSS effektorok (részletezés később) hatására jön létre a microvillusok eltűnése és az ioncsatorna fehérjék működésének deregulációja, ami következményesen a víz absorpció csökkenését okozza. A microvillus lecsupaszodás az intimin, a MAP (mitochondrion associated protein), TIR és EspF kooperatív működésének a következménye. Az EspF a tight junction széttörésével és a Na-H ion exchanger 3 (SLC9A3, solute carrier family 9 sodium/hydrogen exchanger, member 3, pH reguláló fehérje, 5q15.3, 51 216 bp, 834 AA, 92 855 Da, 11 fehérje kapcsolat, 1174 SNP)                 aktivitásának a csökkentésével rontja a Na+ absorpciót. Az EspG és EspG2 microtubularis változásokat okoz, ami gátolja a Cl- - OH- exchange protein (SLC26A6, solute carrier family 26, member 6, pendrin-like protein 1, anion transzporter, klór, oxalát, szulfát, bikarbonát transzport, 3p21.3, 9 771 bp, 759 AA, 82 967 Da, 108 SNP) aktivitását. Az EspF és G károsítja az aquaporinok (AQP1-12, az aquaporinok kisméretű integrált membrán proteinek, a fő intrinsic protein család tagjai /MIP, major integral membrane protein, AQP0/, víz csatornák, homotetramer szerkezetűek, a membránt hatszor átívelő fehérjék, vörösvértestek és vesetubulus membrán igen nagy mennyiségben tartalmazza, pl. aquaporin 1, AQP1, a Colton vércsoport antigén, 7p14, 13 717 bp, 269 AA, 28526 Da, 16 protein kapcsolat, 233 SNP, www.genecards.org) membránba történő lokalizálódását, ezzel rontva a víz transzportot. A két protein gátolja a sodium-D-glucose cotransporter (SGLT1, solute carrier family 5, 22q12.3, 69 998 bp, 664 AA, 73 498 Da, 5 protein kapcsolat, 915 SNP, www.genecards.org) és az intestinalis serotonin transporter (SERT, a plazma membránt 12-szer áthidaló szerotonin transzporter, 17q11.2, 41 618 bp, 630 AA, 70 325 Da, 5 protein kapcsolat, 639 SNP, www.genecards.org) működését. Az SGLT az egyik legjelentősebb vízpumpa, amelyet az intimin és a MAP (mitokondrium asszociált protein, 178 AA) gátol. 

 

A SERT a serotonin felvételét végzi a bélrendszerben, amely lényeges az intestinalis absorpció, az elektrolitok és a víz szekréciójának szabályozásában. A connexin43 (CX43) gap félcsatornák (6q22.31, 14 129 bp, 382 AA, 43 008 Da, 67 protein kapcsolat, 247 SNP, www.genecards.org) az enterociták apicalis felszínén nagyfokban expresszálódnak intestinális fertőzések során, amelynek következtében jelentősen fokozódik a luminális víztartalom. Ezek a kombinált vízabsorpciót és ion egyensúlyt megzavaró tényezők felelősek az A/E pathogének mediálta hasmenéses folyamat kialakulásáért,  de számos tényező még tisztázásra szorul.

Az EHEC törzsek virulencia faktorai

Adherencia faktorok

Ecp: E. coli common pilus, píluson lévő adherencia faktor, ami alapvető az E. coli O157 emberi törzsek virulenciájában. A faktor azonban megtalálható a kommenzális E. coli törzsekben is, és ennek alapján úgy gondolják, hogy a pathogén E. coli törzsek mimikriként használják. A kommenzális E. coli törzsekhez való hasonlóság ökológiai előnyt biztosíthat a gazda kolonizációjában és az immunrendszer egyes hatásainak elkerülésében.

Efa1/Lifa: EHEC factor for adherence/ Lymphocyte inhibitory factor, adhezinként működik a non O157: H7 EHEC törzsekben és funkcionális szempontból gátolja a limfocita aktivációt.

Intimin: a LEE locusban kódolt, külső membrán fehérje, az N terminális horgony rész rögzíti a proteint az EHEC törzsek külső membránjában és a génszekvencia általában nem nagyon változó. A C terminális intimin rész nyúlik ki a baktérium felszínéről és kötődik a TIR receptorhoz. A C terminális rész szekvenciáját tekintve igen változékony, amely szerepet játszik a szöveti tropizmus kialakításában.

 Az intimin TIR-hez való kötődése drámai intracellularis változásokat indít el, átrendeződik a citoszkeletális rendszer, a bakrétium kontaktus helyén aktin polimerizáció jön létre, és morfológiailag kialakul a jellemző A/E lézió. Az alternatív intimin receptor a béta 1 integrin (az integrinek alfa és béta láncok kombinációjából felépülő heterodimer, a sejtek környezükhöz, az extracelluláris mátrixhoz történő kapcsolódását irányító membrán receptorok. Az alfa alegységek génjei ITGA 1-11, ITGA D-X, a béta alegységek génjei ITGB 1-8. A sejtek adhézióján az extracelluláris mátrix hatásainak közvetítését is végzik. Részt vesznek a sejtosztódás, növekedés, differenciálódás, migráció, apoptózis szabályozásban, a vérlemezkék és az immunrendszer működésében. Kötőhelyei lehetnek egyes vírusoknak, adeno-, echo-, Hanta- és száj és körömfájás vírusoknak).  

További intimin kötő fehérje a nucleolin. A nucleolin az eukaryota sejtek egyik fő multifunkcionális nukleáris foszfoproteinje. Tripartit funkciójú, melyeket különböző domainek hoznak létre, specifikus DNS helikáz, DNS dependens ATP-ase aktivitású és szekvencia specifikus RNS kötő protein. A B sejtek specifikus transzkripciós faktora, részt vesz a riboszómális biogenezisben, nukleogenezisben, sejtproliferációban és növekedésben, kromatin remodellingben és citokinezisben. Számos protein komplex tagja. 710 aminosavat tartalmaz, 76 614 D molekula tömegű, 20 exonból álló fehérje, 788 protein kapcsolata és 264 single nucleotid polimorfizmusa (SNP) ismert. A gén a 2q37.1 kromoszóma régióban kódolt, mérete 30111 bp (www.genecards.org.) A H1 hisztonhoz kapcsolódva az intranuklearis kromatin állományban dekondenzációt eredményez. Erősen kötődik RNS –ben jelenlévő 5’-UUAGGG-3’ ismétlődő szekvenciákhoz, gyengébben pedig a telomer területén jelenlévő egyszálú DNS 5’-TTAGGG-3’ ismétlődésekhez. Riboszómális kötődése során elősegíti a riboszómákösszegyűlését és a pre-rRNS transzkripcióját.

Az EHEC törzsekben az intimin a membránban expresszálódó TIR molekulák
az intimin a membránban expresszálódó TIR molekulák mellett a nucleolin molekulákhoz is kötődik és a kapcsolódás inzulin receptor thyrosin kináz szubsztrát és TIR citoskeleton coupling proteinen keresztül vezet az N-WASP- Arp2,3 kapcsolódáshoz és aktivációhoz, továbbá az actin-citoszkeleton átrendeződéshez. A STX2 fokozza a nucleolin expressziót és a membránba kerülést, növelve ezzel az EHEC gazdasejtekhez történő adherenciáját.

Paa: porcin attaching-effacing associated protein. A Paa génszekvencia gyakran megtalálható az O157: H7 A/E törzsekben. A Paa aminosav szekvencia identikus az O157: H7 EDL933 és a Sakai törzsekben és jelentős homológiát mutat az AcfC V. cholerae attaching-effacing asszociált proteinnel. A fehérje a bakteriális adherencia iniciális tényezője, az A/E aktivitáshoz szükséges.

Toxin

ToxB (toxin B): 362 kD protein, az O157: H7 törzsek 93 kD-os plazmidján kódolt, génje a toxb. Más EHEC törzsek is tartalmazzák, és szekvencia hasonlóságot mutat a clostridium toxin családdal és az EFA1/LifA proteinnel. Funkcionális szempontból lényeges komponens a teljes adherencia kialakulásában és néhány virulencia faktor termelődésében és szekréciójában, az A/E léziók létrejöttében.

Vasfelvétel

Chu: E. coli hemin uptake, a chuA gén által kromoszómálisan kódolt 69 kD külső membrán protein, amely a hem felvételét végzi. Homológiát mutat az azonos funkciójú S. dysenteriae 1 shuA génnel. A gének egy nagyobb locus, az ún. hem transport locus területén helyezkednek el, amely a pathogén E. coli törzsekben széles körben fordul elő. A hem, vagy hemoglobin vas forrásként történő felhasználásának képessége a pathogén baktériumok számára jelentős szelekciós előnyt biztosít. Ezek a pathogén baktériumok gyakran szekretálnak citotoxinokat, amelyek eljutnak az intracellularis hem rezervoirhoz, és elősegítik a kórokozók szöveti invázióját. A citotoxin termelés és a hem vagy hemoglobin felhasználás képessége igen effektív vasnyerő stratégia az infekciók progressziója során.

EspP: EHEC secreted protease, a pO157 plazmidon kódolt szerin proteáz és autotranszporter, az V-s alvadási faktort hasítja.

StcE: secreted protease of C1 esterase inhibitor from EHEC, a pO157 plazmidon kódolt proteáz enzim, amely a szerin proteáz inhibitorok közé tartozik. A II-es típusú szekreciós apparátus szekretálja és a Ler transzkripcionális aktivátor hatására termelődik. Az StcE termelődés összekapcsolódik az LEE locus génejeinek aktivációjával. A C1 észteráz inhibitor hasítása mellett a T sejtek aggregációját is előidézi. A C1 észteráz inhibitor (serpin peptidase inhibitor, clade G C1 inhibitor member 1, 11q12-13.1, 17 467 bp, 500 AA, 55 154 Da, 43 fehérje kapcsolat, 264 SNP, www.genecards.org.), alapvető regulátora a klasszikus és az alternatív komplement útnak, az alvadás intrinsic és kontakt aktívációs útjainak. A komplement cascade dysruptiója hozzájárul a szöveti károsodás fokozódásához, az intestinális oedema létrejöttéhez és a thrombotikus citopénia pathomechanizmusához.

Ler: LEE encoded regulator, a LEE1 operon első génje. Hasonlóságot mutat a hiszton szerű proteinek családjával, főként a H-NS proteinnel (H-NS: Histone like, nucleoid-associated DNA-binding protein).129 AA aminosavból áll, aktiválja az LEE2, LEE3, TIR és az Orf 19 promotereket, valamint szükséges a LEE4 expresszióhoz is. Nem szükséges az LEE1 promoter aktivációjához. Az LEE locuson kívül elhelyezkedő gének közül aktiválja az EspC-t (Esp: E. coli törzsek által szekretált proteinek, pl. EHEC secreted protein), valamint különböző típusú fimbriák proteinjeinek génjeit. Antirepresszor proteinként megszünteti a H-NS mediálta LEE2 /LEE3 promoter régióra gyakorolt silencing hatást.

TTSS, type III. (three, 3) secretion system: A LEE patogén sziget területén kódolt rendszer.

Haemolysin (Hly) membránkárosító, pórusformáló RTX típusú toxin, az I. típusú szekreciós rendszer révén szekretálódik. A toxin citotoxicus hatású az erythrocytákra, granulocytákra, monocytákra, endothel sejtekre, renális epithel sejtekre. Stimulálja az IL-1béta (IL1B gene, proinflammatorikus, multifunkcionális citokin, caspase 1 aktiválja, 2q14, 7 153 bp, 269 AA, 30748 Da, 62 fehérje kapcsolat, 179 SNP) és a TNF-alfa (Tumor necrosis factor ligand superfamily member 2, TNFSF2, cachectin, proinflammatorikus multifunkcionális citokin, a TNF ligand szupercsalád tagja, 6q21.33, 2 770 bp, 233 AA, 25 644 Da, 90 kapcsolódó fehérje, 82 SNP) felszabadulását (www.genecards.org.). A toxin a vörösvérsejtek felszínén glycophorinhoz, a leukocytákon pedig béta 2 integrinekhez kötődik, majd ezt követően inzertálódik a sejtmembránba.

Cif: cycle-inhibiting factor. A TTSS rendszerrrel transzlokált fehérje, amely gátolja a sejtciklus G2/M fázisának tranzicióját a CDK1 (cyclin dependens kinase 1, 10q21.1, 16 522 bp, 297 AA, 30 095 Da, 742 protein interakció, 263 SNP,www.genecards.org.) inaktíválása révén. Az EPEC és EHEC törzsekben jelen lévő lambdoid profágon kódolt.

EspA: EHEC secreted protease A, a TTSS rendszer révén transzlokálódó protein, a TTSS apparátus része. Adherencia tényező, filamentozus struktúrát képez a baktérium sejt felszínén az A/E léziók kialakulásának korai stádiumában. Fizikai kapcsolatot alakít ki a baktérium sejt felszíne és az infektált eukaryota sejt felszíne között. Szükséges az EspB és EspD transzlokációjához. Génje az espA. Az LEE patogén sziget TTSS-t kódoló clusterében helyezkedik el a espL és az espD gének között.

EspB: EHEC secreted protease B, a TTSS rendszer tagja, az esp filamentumok révén átjut a gazdasejt membránjába és pórust képez az espD-vel a gazdasejt membránban, elősegítve más effektor molekulák bekerülését a gazdasejtbe, és maga is effektor molekulaként működik. Génje az espB, amely az LEE patogén sziget területén a TTSS clusterben az espD és a Z5104 gének között helyezkedik el.

EspD: EHEC secreted protease D, TTSS apparátus proteinje. Átjut az EspA filamentális szerkezeten és az EspB-vel pórust képez a gazdasejt membránjában, más effektorok bejutása számára. Valószínűleg az EspD is betölt effektor funkciót. Génje az espD, amely az LEE patogén sziget TTSS clusterén belül az espA és az espB gének között helyezkedik el.

EspF: EHEC secreted protease F, a TTSS rendszer által transzlokált protein. 206 aminosavat tartalmaz (AA), három identikus prolin gazdag szekvencia található a fehérjében, amely hasonlít az eukaryota SH3 domaint tartalmazó szignalizációs fehérjék aminosav szekvenciájára. A fehérje funkciója a tight junction integritás csökkentése, az occludin tight junction asszociált fehérje (OCLN gene, 5q13.1, 65 813 bp, 522 AA, 59 144 Da, 21 fehérje kapcsolat, 184 SNP,www.genecards.org.) redisztribuciójának megváltoztatásával. A protein az apoptosis indukcióját is előidézi. Génje az espF, mely az LEE régióban két hipotetikus protein között helyezkedik el, a 67047-67931 bp között.

EspG: EHEC secreted protease G, a TTSS rendszer transzlokálódott proteinje, szekvencia hasonlóságot mutat az EPEC törzsek EspC patogén szigetében elhelyezkedő orf3 gén és a Shigella flexneri VirG fehérjével. Funkciója ismeretlen. Génje az espG.

EspH: EHEC secreted protease H, a TTSS rendszer transzlokálódott proteinje, a phylopodiumok és a gazdasejt membrán A/E lézió alakzat kialakulását szabályozó fehérje az EHEC és EPEC törzsekben. Génje az espH.

Map: mitokondrium asszociált protein, a TTSS apparátus transzlokált fehérjéje, a gazdasejt mitokondriális membránját károsító protein, amely a mitokondrium membrán potenciált befolyásolja és a phylopodium képződést is szabályozza.

NleA/EspI: non-locus –of enterocyte-effacement-encoded effector A fehérje, TTSS apparátus transzlokált proteinje, génje az nleA, amely profág asszociált patogenicitási szigeten belül kódolódik az EHEC és EPEC törzsek genomjában, valamint más LEE patogenicitási szigetet tartalmazó baktériumokban. A Golgi mannosidase II enzimmel co-lokalizálódik és együtt transzlokálódik a gazdasejtekbe. Közelebbi funkciója nem tisztázott.

NleC: non-locus –of enterocyte-effacement-encoded effector C fehérje, TTSS apparátus transzlokált proteinje, részt vesz a gazdasejt citoszkeletális átrendeződésében, génje az nleC, lokalizációja az LEE patogenitási szigeten kívüli profág génterület.

NleD: non-locus –of enterocyte-effacement-encoded effector D fehérje, TTSS apparátus transzlokált proteinje, részt vesz a gazdasejt citoszkeletális átrendeződésében, génje az nleD, lokalizációja az LEE patogenitási szigeten kívüli profág génterület.

Tir: transzlokálódott intimin receptor (translocated intimin receptor), a TTSS apparátus transzlokálódott proteinje, génje a tir, ami a Z5113 és a Z5111 génrészleltek között helyezkedik el az LEE patogenitási sziget TTSS clusterében. Az EHEC és EPEC törzsek Tir fehérjéjének funkciója különbözik. Gazdasejt membránjában kialakuló protein komplex az EPEC törzsekben a Tir tirozin foszforilációja után az NCK (non-catalytic region of tyrosine kinase adaptor protein 1,2) adaptor proteinnel kapcsolódik, amely azután az NWASP/ ARP2,3 proteineken keresztül vezet az aktin citoszkeleton modifikációjához. Az EHEC törzsekben az intimin Tir-hez és nucleolinhoz kapcsolódik a gazdasejt membránjában. A Tir itt nem foszforilálódik és nem NCK adaptor proteinen, hanem inzulin receptor tirozin kináz szubsztrát fehérjén (BAIAP2L1, IRSp53) és TCCP/EspFu (Tir cytosceleton coupling protein) fehérjéken keresztül kapcsolódik az NWASP/ ARP2,3 fehérje komplexhez és indítja el az aktin citoszkeleton átrendeződést.

Az EPEC és EHEC törzsek Tir domainjének szerkezete különböző, a két törzs esetében a homológia 44%-os.

EPEC törzsek patomechanizmusa

Az EPEC főként a csecsemőkben, kisgyermekekben okoz hasmenést, amely vízszerű, de vörösvérsejtek is megjelennek a székletben. A gyulladás kisfokú, láz nincs, a tüneteket nem a toxin, hanem a baktériumok inváziója okozza. A törzs közepesen invazív (kevésbé, mint a Shigella, vagy az EIEC), nem termel labilis, vagy stabil toxint. Szórványosan termelhet Shiga-szerű toxint. Adhesinje az intimin és az EPEC adherencia faktor.

Az EPEC törzsekre jellmező hisztopatológiai lézió az ún. tapadási és lecsupaszítási (attaching and effacing, A/E) lézió. Az EPEC törzsek nagy virulencia plazmidja, az EAF (EPEC adhesion factor) kódolja az EPEC adhaesios faktorát, az epithelialis sejtekhez való tapadást közvetítő pílus köteg fehérjéket. A tapadási mintázat az EPEC törzsekre jellemző ún. lokalizált adherencia, (LA, localized adherence) clusterek vagy mikrokoloniák alakulnak ki a gazdasejt felszínének bizonyos részein. Ez az LA mintázat kizárólag az EPEC coli törzsek sajátossága, és az EPEC törzsek diagnosztikájában használatos jelenség.

A törzsek főbb virulencia faktorai:

Adherencia faktorok: Bfp, intimin, lymphostatin/LifA, Paa

Proteáz: EspC

Regulációs mechanizmusok: Ler, Per

Szekréciós rendszer: TTSS

Toxinok: Cdt, EasT1

TTSS révén transzlokált fehérjék: Cif, EspA, EspB, EspD, EspF, EspG, EspH, Map, NleA/Esp1, NleC, NleD, Tir

Patogén szigetek: EspC sziget, Lee (EPEC)

Epidemiológiai szempontból az EPEC fertőzések legkülönlegesebb vonása a jellemző életkori előfordulás. Elsősorban két évnél fiatalabb gyerekek megbetegedését okozza, ezek közül is főleg a hat hónapnál fiatalabbakét. Két év feletti életkorban az EPEC törzsek mind egészséges, mind beteg gyermekekből izolálhatók, de már nem figyelhető meg szignifikáns összefüggés a baktériumok előfordulása és a betegség kialakulása között. Felnőtt önkéntesekben a gyomrosav neutralizálása után 108-10 csíraszámban okozott hasmenést. Gyermekekben a természetesen előforduló fertőzések során előforduló csíraszám nem ismert, de feltehetőleg sokkal alacsonyabb. Az életkori előfordulási sajátosság magyarázatára feltételezik, hogy a korral egyes specifikus receptorok száma valószínűleg csökken.  Úgy gondolják, hogy elsősorban fiziológiai és nem immunológiai alapja van annak, hogy felnőttekben az EPEC infekciók előfordulásának a valószínűsége kisebb. Az EPEC nem szerepel az utazók hasmenésének kórokozói között, még azokban a fejlődő országokban sem, ahol mind az ETEC, mind az EPEC törzsek endémiásak. Az EPEC törzsek is okoztak alkalmanként hasmenés járványokat, felnőttekben is és előfordulnak sporadikus EPEC fertőzések védekező képességet csökkentő kórállapotokban, pl. diabetesben, időskorban, achlorhydria esetén. Az EPEC fertőzések átvitele is faecalis oralis úton történik, elsősorban kontaminálódott kézzel, élelmiszerrel. Csecsemőkorban a fertőzés elsősorban nozokomiális, közösségekben, kórházakban, csecsemőotthonokban fordul elő. A tünetmentes hordozás és ürítés a két éven aluli egészséges csecsemők 17-20%-ban fordul elő. Megbetegedés esetén az ürítés a tünetek megszűnése után még további két hétig tarthat.

Az 1940-50-es években, az USA-ban és az UK-ban a közösségben szerzett és nozokómiális csecsemőkori hasmenések közel 50%-ában az EPEC szerepelt kórokozóként, 25-50 %-s halálozást okozva. Ez a későbbiekben jelentősen csökkent. Az elmúlt harminc évben regisztráltak néhány nagyobb EPEC járványt az USA-.ban, UK-ban és Finnországban többnyire csecsemőotthonokban és gyermekosztályokon. Felnőttek között megfigyeltek atípusos sporadikus EPEC eseteket is (az EAF plazmidot nem tartalmaző EPEC törzsek). A fejlődő oszágokban az EPEC a csecsemőkori hasmenések fő kórokozója, Brazíliában Mexicóban, Dél-Afrikában az EPEC volt a kóroki tényező a csecsemőkori hasmenések 30-40 %-ában, felülmúlva a Rotavírus incidenciáját is. Megfigyelték, hogy a szoptatás protektív hatású az EPEC ellen, a tejben lévő szekretált IgA és oligoszacharid fragmentumok adherencia gátló hatása következtében. A klinikai kép proffúz vizes hasmenés, hányás, hőemelkedés, széklet leukocitózis csak alkalmanként fordul elő, jelezvén a hasmenés inflammatorikus okát. A leukocita kimutatásnál érzékenyebb teszt az anti-lactoferrin agglutinációs vizsgálat. Az EPEC definícióját a II-ik Nemzetközi EPEC Szimpózium, a korábbi O szerocsoportú, illetve O:H szerotípusú diagnózisról az A/E hisztopatológiai lézió, az EAF plazmid jelenlétének kimutatására és a Shiga toxin kimutathatóságának hiányára alapítja. Az A/E lézió kimutatására szolgáló funkcionális teszt a HEp-2 vagy HeLa sejt adherencia, majd a FAS (fluorescent actin staining test) vizsgálat, a genetikai teszt pedig a LEE patogenicitási sziget génterületének, az EspB, sep vagy az intimin N terminális konzervált régiójának kimutatása oligonucleotid próbával történő hibridizációval, illetve PCR vizsgálattal. A Shiga toxin kimutathatósága (Vero sejt toxicitás) EHEC, hiánya pedig EPEC törzsek jelenlétét valószínűsíti. Az EAF plazmid a BFP adhesint és a per regulátort (plasmid encoded regulator, szabályozza a BFP és az eae gének expresszióját) kódolja. Típusos EPEC törzseknek az EAF plazmidot tartalmazókat, atípusos EPEC törzseknek pedig az EAF plazmidot nem tartalmazókat nevezik. Ilyen atípusos O39:NM E. coli (nem típusos EPEC O szerocsoport) törzs okozott élelmiszer közvetített járvány Minnesota-ban. Egy másik, szintén EAF negatív, O111, típusos EPEC O szerocsoportú baktérium törzs okozott járványt felnőttekben és iskoláskorú gyermekekben, Finnországban (600 fő betegedett meg).

A hasmenést okozó EPEC törzsek általában tartalmaznak EAF plazmidot, de mint az előzőekből látható, alkalmanként EAF negatív törzsek is képesek az A/E lézió előidézésére. Megfigyelték azt is, hogy önkéntes EPEC-vel fertőzött személyek székletében megtalálható baktériumok spontán módon elvesztették EAF plazmidjukat. Ilyen módon ezek az EAF negatív EPEC törzsek a fenti módszerekkel azonosnak bizonyulhatnak az stx toxint tartalmazó fágjukat elvesztett EHEC baktériumokkal.

Adherencia faktorok

Az EPEC törzsek adherenciája több lépéses folyamat. Az első lépés a kötegformáló pílusok (BFP, bundle forming pili) kapcsolódása a mikrovillusokhoz. Ezt követően kialakul a mikrovillusok pusztulása (attaching and effacing laesio, tapadás és lecsupaszítás) és az epithél sejtek szignalizációs folyamatainak megváltoztatása, a III-as típusú szekréciós rendszeren át történő EspA, B, D és Sep epithel sejtekbe juttatásának következtében. A harmadik lépésben kialakul a TIR-intimin kapcsolat és a kiboltosulás (talapzat, pedestal, piadestal, hasonlóan az EHEC törzsekhez), az ún. intim adherencia. A piadestal akár 10 um méretű, álláb szerű kiboltosulás az epithél sejtek felszínén. Az ezen ülő EPEC baktériumok mozognak az epithél sejtek felszínén, ami a struktúra alatt létrejövő aktin polimerizációval függ össze. Az aktin polimerizációs jelenséget használják fel in vitro az E/A léziót mutató baktériumok, így az EPEC törzsek diagnosztikájában is. Fluorescein isothiocyanát festékkel jelzett phalloidin (FAS teszt, fluorescent actin staining) specifikusan kötődik az epithelialis sejttenyészet sejtjeiben a letapadt baktériumok alatti aktin polimerizációs területhez (újabban a toxicus phalloidin helyet alfa actinin festést alkalmaznak).

BFP: Bundle forming pili. A rendszer génjei a bfpA, B, C, D, E, F, G, H, I, J, K, L, P, Q.

IV-es típusú pilus rendszer, a baktérium gazdasejt adherenciában játszik szerepet. A bfp géncluster az EAF (EPEC adherence factor) plazmidon helyezkedik el. Az EAF plazmid per locust tartalmaz (plasmid encoded regulator), amelynek produktuma szabályozza mind a BFP operont, mind az LEE patogenicitási sziget génjeit, az utóbbit a LER (LEE encoded regulator) irányításával.

A IV-s típusú, B osztályú fimbriák jelen vannak az ETEC, a Salmonella typhi és a Vibrio cholerae törzsekben is.

A BFP géncluster számos fehérjét kódol (A-Q-ig), közöttük bundlint- BFPA, secretint-BFPB, NTP kötő fehérjéket-BFPD, F, pilin szerű proteineket-BFPI, J, K, prepilin peptidaset-BFPP, transglukozilázt-BFPH stb.

A pilusok szerepet játszanak az adherenciában és az autoaggregációs fenotípus kialakulásában.

Intimin: az EPEC törzsek intimin proteinje 94 kD-os külső membrán fehérje, az LEE patogenicitási szigeten belül az eae génterületen kódolódik. Az intimin fehérje szekvenciája kis különbségeket mutat az EPEC törzseken belül, amelynek alapján 9 intimin altípust különböztetnek meg, és ezeket görög betűkkel jelölik. Az EPEC törzsek gezdesejtekhez történő kapcsolódása esetén az intimin-Tir kötődést a Tir 474. pozíciójú tirozinjának foszforilációja követi. A receptorhoz ezután kötődik az NCK adaptor és az NWASP/ ARP2,3 fehérje komplex, ami elindítja az aktin nucleációt. A Tir transmembrán 1-es domainjének N terminális végéhez alfa aktinin és tallin is kapcsolódik. A citoszkeletális proteinek és az aktin polimerizációja az A/E léziókra jellemző eltérés a szoros bakteriális kontaktus létrejöttekor. Alternatív intimin kötőhelyek az enterociták felszínén a béta1 integrin (integrin gén és fehérje család tagja, INTG gene, integrin beta 1, fibronectin receptor beta polypeptide, CD29, VLA very late beta antigén, sejtfelszíni, adhéziós fehérjéket kötő, alfa és béta aleegységekből felépülő struktúrák, a béta 1 gén a 10q11.2 területen található, 105 475 bp, 798 AA, 88 415 Da, 235 fehérje interakció, 712 SNP, www.genecards.org.) és a nucleolin.

Lymphostatin/LifA/Efa1(lymphocyte inhibitory factor / EHEC factor for adherence): az adherenciában részt vevő, nagyméretű 385 kD molekula tömegű fehérje, ami az LEE patogén szigeten kívül kódolódik. Az EPEC törzseken kívül az EHEC törzsekben is jelen van. A fehérje részt vesz a baktériumok adherenciájában, és gátolja számos limfokin pl. az IL-2 (IL interleukin, T és B limfociták proliferációját irányító citokin, 4q26-q27, 5256 bp, 153 AA, 17 628 Da, 115 fehérje kapcsolat, 112 SNP), IL-4 (immunregulációs szignált közvetítő ligand, Th2 /humorális/ immunválaszt segít, 5q31.1, 8996 bp, 153 AA, 17 492 Da, 63 fehérje kapcsolat, 227 SNP), IFN gamma (interferon, IFNG, immunreguláló, antivirális, sejtproliferációt gátló citokin, az interferon család tagja, 12q14, 4980 bp, 166 AA, 19 348 Da, 88 fehérje kapcsolat, 140 SNP) transzkripcióját és a limfociták proliferációját (www.genecards.org.).

Az immunválasz működését irányító citokinek fehérje ligandok. Szabályozzák a sejtproliferációt, defferenciálódást, túlélést illetve apoptózist. A pathofiziológiai állapotokban, infekciók, immunológiai, daganatos betegségek, stb. során a pathmechanizmusok alapvető mediátorai. A veleszületett (monociták, makrofágok, dendritikus sejtek, stb.) és az adaptív (T és B limfociták) immunrendszer sejtjei különféle stimulusokra termelik. A gyulladásos folyamat szempontjából csoportosításuk: pro- és antiinflammatórikus típusú citokinek. Proinflammatorikusak az interferon gamma, interleukin 1, 6, 12, tumor nekrozis faktor alfa, a veleszületett immunrendszer sejtjei és a T helper 1 sejtek termelik, antiinflammatorikusak az interleukin 4, 5, 10, 13, a T helper 2 sejtek termelik.

Paa: porcine attaching-effacing asszociált protein, az A/E törzsekben jelen lévő fehérje, amelyet korábban az EHEC törzseknél ismertettünk. A fehérje a bakteriális adherencia iniciális tényezője és az A/E aktivitáshoz szükséges.

Proteázok

EspC (E. coli -secreted protein C): entero- és citotoxikus proteáz és autotranszporter (I. osztályú SPATE). Az EPEC törzsek egyik fő autotransporter fehérjéje, 110 kD méretű. Más pathogén A/E léziókat okozó baktériumokban is jelen van, azonban ezekben a fehérje nem szekretálódik. A fehérje az A/E léziót indukáló pathogének virulenciájának egyik tényezője. Termelődését a PerA transzkripcionális regulátor irányítja. Az irányító cascade egyik alapvető tényezője a Ler (LEE encoded regulator). Az espC gén az EPEC törzsek kromoszómáján kódolt. Az EspC fehérje citopátiás hatása nem teljesen tisztázott. Hasítja (az EAEC pet-hez hasonlóan) a fodrint (SPTAN1, spectrin alpha non-erythrocytic 1, alpha-fodrin, filamentosus citoszkeletális fehérje), de nem okoz fodrin redistribuciót a sejten belül.

Regulációs elemek

Ler: LEE encoded regulator, l.d korábban az EHEC virulencia tényezőknél.

Per: plasmid encoded regulator, vonatkozó gének perA/bfpT, perB/bfpV, perC/bfpW.

A perA a Xyls/AraC (xylose, arabinose operon regulátor család) családba tartozó transzkripcionális regulátor, a PerB és a PerC kofaktorok. A három protein a bfp géncluster transzkripcionális aktivátora. A regulátorok növelik, a bfp, intimin és több Esp termelődését és szekrécióját, környezeti hatásokra. Aktiválják továbbá a Ler expresszióját, ami azután növeli a LEE 2, 3, 4 és a Tir termelődését cascade szerű hatással.

Szekréciós rendszerek

TTSS: az EHEC virulecia tényezőknél is szerepel. Megjegyzendő, hogy az EPEC, az EHEC, a Salmonella, Shigella és Yersinia törzsek TTSS rendszerében a tűszerű képződmény hossza változó, 50-680 nm között változhat és változik az alaplemez szerkezeti felépítése is (részletesen a szekréciós rendszereknél tárgyaljuk).

Toxinok

CDT: cytolethal distending toxin, intracellularis toxin. DN-ase 1 aktivitású, kromatin disrupciót okoz, amely G2M fázisban sejtciklus gátlást és végül a célsejtek halálát idézi elő.

EAST1 (EnteroAggregative Heat-Stable Toxin 1): membránon ható guanilát cikláz aktivitású hőstabil enterotoxin, 38 aminosavat és 4 cisztein reziduumot tartalmaz és homológ az ETEC STa toxinjával.  Aktiválja a guanilát ciklázt, ami ionszekréciót okoz (ld. korábban is az EAEC virulencia tényezőknél).

A TTSS rendszer által transzlokált fehérjék: Cif, EspA, EspB, EspD, EspF, EspG, EspH, MAP, NleA/EspI, NleC, NleD, Tir azonosak az EHEC virulencia tényezőknél leírtakkal.

Enteropathogen E. coli EPEC pathovariánsok pathogenezise

Az EPEC a fejlődő országokban az egyik fő kóroki tényezője a fatális csecsemőkori hasmenésnek. Ez a patovariáns azon coli törzsek közé tartozik, amelyek ún. attaching and effacing (A/E), tapadó és lecsupaszító jellegű léziókat okoznak az intestinalis epithel sejtek felszínén. Az ilyen típusú léziókat okozó baktérium családba a következő pathovariánsok tartoznak: EHEC, RDEC (rabbit diarrhoeagen E. coli), Citrobacter rhodentium (egérpatogén) és Escherichia albertii (korábban Hafnia alvei), amely utóbbi törzs emberi hasmenés kóroki tényezője is lehet. Az intestinalis epithel sejtek felszínére tapadó baktérium hatására a microvillusok eltűnnek, és a gazdasejt aktin-citoszkeleton rendszere sajátságos alapzatot formál a tapadási hely alatt. A léziók létrejöttéért felelős gének a locus of enterocyte effacement (LEE) területén helyezkednek el, egy 35 kb méretű patogenicitási sziget (PAI, pathogenicity island) területén.

Az LEE locus génjei szigorúan reguláltak és a TTSS (T3SS vagy type III szekréciós szisztéma) rendszer fehérjéit kódolják. Néhány effektor molekula azonban az LEE régión kívűl, az ún. non-LEE területeken helyezkedik el és Nle (non-LEE encoded) effektorként jelölődik. A rendszer több tagjának szerepe jelenleg még nem ismert. Az EPEC törzsek kezdeti, lazább tapadását a vékonybél enterocytáihoz kötegformáló pílusok (bundle-forming pilus, BFP) hozzák létre. Ezek az EPEC adherencia faktoron (EAF) plazmidon kódolódnak. A kötegformáló pílusok kötélszerű fimbriák, amelyek részben más EPEC baktériumokkal is kapcsolódnak és így részt vesznek mikrokoloniák létrehozásában, másrészt a gazdasejt felszínén lévő N-acetil-laktózamint tartalmazó receptorokhoz kötődnek. A BFP mellett a lokalizált mikrokolóniák kialakításában a lokális adhézióképző struktúrák (LA, localised adhesion) is szerepelnek. Újabban megfigyelték, hogy az E. coli törzsek közös pílusa (ECP, E. coli common pili), amely megtalálható valamennyi E. coli izolátumban, szintén részt vesz a kötegformáló pílusokkal együttműködve az EPEC és a gazdasejtek közötti kapcsolat kialakításában. A szorosabb, közvetlen kapcsolódást ezután a baktérium sejt külső membránjában elhelyezkedő intimin és a gazdasejtbe transzlokálódott receptora, a translocated intimin receptor (TIR) alakítja ki. Az EPEC baktériumok a TTSS rendszeren keresztül transzlokálják a gazdasejt citoplazmájába a TIR-t és egyéb molekulákat. A TIR azután a gazdasejt felszínén expresszálódik és receptorként funkcionálva kapcsolódik az intiminnel. Az intimin-TIR kapcsolat a TIR receptorok clusterizációjához vezet és a receptorok intracellularis része gazda tirozin kinázok hatására foszforilálódik. A TIR foszforilációját végző kinázok között szerepel az NCK, amely a TIR-hez kapcsolódik és aktiválja a neurális Wiskott-Aldrich syndroma fehérjét (NWASP) és az actin releated protein 2,3 fehérjét (ARP), amelyek komplexet képezve hozzák létre a jellegzetes talapzat formációt és elindítják az aktin átrendeződést. Az EPEC törzseknek jelentős, a TTSS segítségével a gazdasejtbe transzlokált effektor repertoárja van, amelyek szerepet játszanak a citoszkeletális átrendeződésben, az immunmodulációban és hozzájárulnak a hasmenés pathomechanizmusához. A gazdasejtbe transzlokált effektorok többféle funkciót töltenek be. Ezek közé tartozik a mitokondrium-asszociált protein (MAP), amely VXXXE motívumot tartalmazó fehérje és a kisméretű, sejtosztódást szabályozó fehérje, a Cdc42 (cell division cycle 42 GTP binding protein 25kDa, cell division control protein 42 homolog, Rho szupercsaládba tartozó GTPase, 1q36.1, 40318 bp, 191 AA, 21259 Da, 349 fehérje kapcsolat, 669 SNP, www.genecards.org.) aktivitását szabályozza, mint guanin nucleotid exchange factor. Részt vesz továbbá a filopodiumok létrehozásában. Ezek vékony, átmeneti, sejtfelszíni aktin protrúziók, amelyek körülveszik a bakteriális mikrokolóniákat. A MAP ezen kívül károsítja a mitokondriumok struktúráját és membránpotenciálját.

Egy másik multifunkcionális fehérje az EspF, amely szintén hozzájárul a mitokondriumok destrukciójához és a mitokondriális apoptotikus út aktiválódásához. Az EspF részt vesz még a fagocitózis gátlásában és az enterocyták közötti tight junction diszrupciójában. Az EspF a gazdasejt szignalizációs mechanizmusaihoz hasonlóan befolyásolja a membrán transzport mechanizmusokat.

Az EspB szintén a TTSS révén transzlokált fehérje, amely a TTSS-ben betöltött szerepén kívűl (ld. az EHEC virulencia tényezőknél) gátolja a fagocitózist.

Az LEE fehérjék szintén EPEC virulencia faktorok. Ezek közé tartozik az NleA/EspI, amely csökkenti a protein transzport folyamatokat és hozzájárul a tight junction diszrupcióhoz, az EspJ, amely gátolja a vörösvérsejtek opsonofagocitózisát, és a cycle inhibiting factor (CIF), amely cyclomodulin, és gátolja a sejtciklus progresszióját, valamint apoptozist indukál. Az EspG a klór csatorna gátlása és az aquaporin csatorna stimulációja, az EspF szintén az aquaporin csatorna stimulációja és a Na-H exchange fehérje gátlása, valamint a Na (sodium)-glucose transporter 1 (SGLT) gátlása révén megváltoztatják az ionegyensúlyt és a vízfelszívódási egyensúlyt,  hozzájárulva ezzel a hamenés patomechanizmusához.

Az EPEC okozta hasmenés kialakulásában alapvetőnek tartják az absorptiv mikrovillusok elvesztését az A/E léziók kialakulása során, amely malabsorpció révén vezet hasmenéshez. Felnőtt önkéntesekben azt tapasztalták, hogy az inkubációs periódus igen rövid, kevesebb, mint 3 óra. A hasmenés fellépésének gyorsasága miatt igen aktív szekréciós mechanizmust képzelnek el, amelyhez a fennt említett ionregulációs változások mellett hozzájárul a bél epithel sejtek ion áram rövidzárlati folyamata (Isc, increase in short-circuit current). A hasmenés kiváltásához szükséges a baktériumok epithel sejtekhez történő tapadása és az espB gén működése. Csökken a bél epithel rezisztenciája, fokozódik az intestinalis permeábilitás. Megfigyelhető gyulladásos folyamat elindulása, neutrophil granulocyta transzmigráció. A gyulladásos mediátorok, TNF alfa, IL8, IL1 tovább növeli az Isc-t és a klór szekréciót.

Megfigyelték, hogy az EPEC törzsek képesek belépni az epithel sejtekbe, azonban nem mutatnak valódi intracellularis pathogénekre, mint Shigella, EIEC, utaló pathogén folyamatokat, pl. fagocita vacuolumokból történő kiszabadulást. Az invazivitás a BFP fimbriák, az eae és az espB gének épségéhez kötött.

EIEC törzsek patomechanizmusa és virulencia tényezői

Az EIEC törzsek a Shigella törzsekhez hasonlóan dysenteria szerű hasmenést (nyákos, véres) és súlyos gyulladást okoznak a vastagbélben (kezdetben a disztális ileumban). A hasmenés lázzal jár, a törzs invazív, penetrálja a bélhámsejteket és szaporodik bennük. Shiga (verotoxin)-t nem termel, adhezinjei nem fimbriálisak. A gastrointestinális pathogén E. coli törzsek többsége extracelluláris marad, az EIEC törzsek azonban intracelluláris pathogének.

Az EIEC törzsek virulencia faktorai identikusak a Shigella speciesekéivel. Az EIEC törzsek okozta dysenteriform hasmenés klinikailag megkülönböztethetetlen a Shigella spp-k által okozott dysenteriától. Az EIEC törzsek biokémiai jellemzői is azonosak az E. coli törzsekével. Genotípus és fenotípus jellemzők tekintetében is a Shigella törzsekkel mutatnak azonosságot. Az EIEC törzsek a S. flexneri plazmidjával homológiát mutató és azokkal funkcionálisan egymást helyettesíthető nagy plazmidokat tartalmaznak. A Shigelláktól (S. flexneri, sonneii, dysenteriae) eltérően azonban, amelyeknek ID 50 (infective dose, betegséget okozó kórokozó szám) értéke alacsony, 5000 organizmus alatti, az EIEC törzsek esetén 100 millió baktérium szervezetbe kerülése szükséges a betegség kialakulásához.

A Shigella és az enteroinvaziv coli törzsek áthatolása az enterocyta barrieren 2 féle mechanizmussal, az M sejteken keresztül és paracellulárisan történik.

Jelenleg elfogadott, hogy az EIEC és a Shigella törzsek közös pathovariánsok, közös a pathogén mechanizmusuk. A Shigella genus neve azonban ma is megtartott, a shigellozissal, a dysenteriával való asszociáció miatt. A Shigella törzsek igen fertőző kórokozók, bacillaris dysenteriát, véres hasmenést okoznak. Az EIEC és a Shigella pathovariáns a pathomechanizmus tekintetében különbözik más gastrointestinális E. coli pathovariánsoktól. Ezek obligát intracellularis kórokozók, nincs flagellumuk és adherencia faktoruk.

Az EIEC virulenciája a 220 kb méretű plazmidon kódolt génjeivel függ össze. Ezek közé tartozik az Mxi-Spa locus, amely részben a TTSS-t kódolja, részben szükséges a baktériumok inváziójához, a sejt túléléséhez, valamint a makrofágok apoptózisának indukciójához. Az EIEC baktériumok a colon microfold (M) sejtjein keresztül jutnak át transcitózissal az epithelialis rétegen és a submucosa makrofág sejtjeibe kerülnek felvételre. A submucosába jutást és a gyulladásos folyamat elindulását a tight junction diszrupciója és az epithel sejtek károsodása idézi elő. A gyulladás kialakulásakor a baktériumok közvetlenül elérik a submucosát. A submocosa rezidens makrofágjai az M sejtekből kikerült baktériumokat fagocitálják. A fagoszomákban a baktériumok életben maradnak és caspase 1 (CASP1, caspase 1 apoptosis-related cysteine peptidase, interleukin 1 beta convertase, IL-1 beta-converting enzyme /ICE/, a caspase-ok az apoptózist végrehajtó, egymást szekvenciálisan aktíváló, cascadeként  működő cystein aspartase-ok, CASP1-14, a CASP1 IL-1 aktiváló enzim és inflammosoma alkotó protein is, 11q23, 75 989 bp, 404 AA, 45159 Da, 59 fehérje kapcsolat, 209 SNP, www.genecards.org.) függő inflammosoma aktiváció révén a kórokozók kiszabadulnak a fagoszomákból és kijutnak a makrofágokból. A caspase 1 aktivációjának elindítója az IpaB bakteriális fehérje.

A caspase 1 aktiváció végeredményben a makrofág sejtek pusztulását okozza. A makrofágokból kiszabaduló baktériumok a colonocyták basolateralis részén CD44 (CD44 molecule, vércsoport antigén, Indian /indiai/ blood group, szinonímák: homing function and Indian blood group system, chondroitin sulfate proteoglycan 8, hematopoietic cell E- and L-selectin ligand, extracellular matrix receptor III, Heparan sulfate proteoglycan, Hyaluronate receptor, Phagocytic glycoprotein 1, és még számos, sejtfelszíni adhéziós protein, amely a sejt adhézióban, migrációban és sejtkapcsolatokban játszik szerepet, 11p13, 93 533 bp, 742 AA, 81538 Da, 17 protein isoform, 86 fehérje kapcsolat, 2380 SNP, www.genecards.org.) és alfa5 béta1 integrin receptorokon keresztül lépnek be a colonocytákba. A CD44 kötődésért szintén az IpaB fehérje felelős. A baktériumok által szekretált IpaC protein aktiválja a bakteriális kontaktus helyén az src kinázokat, amely ARP 2,3 protein komplex toborzását indítja el. Ez aktin polimerizációt, valamint a baktériumok sejtbe való bejutását elősegítő membrán kitüremkedések létrejöttét idézi elő. A membrán kitüremkedés kialakulásában az IpgB1 (ipg: invasion plasmid gene, ipa: invasion plasmid antigen) bakteriális protein hatására létrejövő Rac1 (Ras-related C3 botulinum toxin substrate 1, rho kis molekulatömegű G protein család tagja, rho: ras homolog gene family, ras: rat sarcoma viral oncogene homolog) aktiváció is közrejátszik. Az IpgB1 a RhoG-hez hasonló módon aktiválja az ELMO (engulfment and cell motility) fehérjéket (ELMO proteinek: ELMO1-3, ELMO2P1, ELMOD1-3. ELMO 1 ced 12 homológ /C. elegans/, a bekebelezés, sejtmozgást irányító gén és fehérjecsalád, 7p14.1, 594 892 bp, 727 AA, 83829 Da, 15 fehérje kapcsolat, 8193 SNP) és a DOCK180 (dedicator of cytokinesis) proteint (DOCK1 gene, dedicator of cytokinesis 1, citoszkeletális átrendeződésben részt vevő, sejtfelszíni kitüremkedéseket irányító fehérje, apoptotikus sejtek fagocitózisa, sejtmotilitás szabályozása, a rho családtagok guanin nukleotid exchange factora, a rac aktívátora, 10q26.13-q26.3, 656 804 bp, 1865 AA, 215 346 Da, 585 fehérje kapcsolat, 6758 SNP), amelyek azután a RAC1-en, az ARP2,3-n keresztül kiváltják az aktin polimerizációt és a membrán kitüremkedések kialakulását (www.genecards.org.). Ezeken a membrán kitüremkedéseken keresztül azután további baktériumok lépnek be a colonocytákba a CD44 (CD: cluster of differentiation) és az alfa5béta1 integrin receptorok közvetítésével.

A pathomechanizmus további effektorai az IpgD, az IpaA, és a VirA (vir: virulence). Ezek részt vesznek az aktin és a microtubularis rendszer destabilizációjában és elősegítik a baktériumok invázióját a fagoszomákba és a fagoszomákból való kijutásukat. A folyamatban résztvevő további bakteriális proteinek az IpaB, C, D, H. Miután a baktériumok az epithel sejtek citoplazmájába kerülnek, további fehérjéket használnak a gazdasejt folyamatainak megváltoztatására. Az intestinalis epithel sejt turnover megállítását az IpaB végzi, az anafázisban meggátolva a sejtciklust a MAD2L2 (mitotic arrest deficient-like 2) proteinhez való kötődéssel (MAD2 mitotic arrest deficient yeast homolog-like 2, a mitotikus orsó összeépülésének ellenőrzési pont kontroll fehérje komplexének tagja, adaptor protein, részt vesz az anafázis megállításában, amíg a kromoszómák pontosan el nem rendeződnek a metafázis lemezen, 1p36, 17 171 bp, 211 AA, 24334 Da, 57 fehérje kapcsolat, 231 SNP, www.genecards.org.).

Egy másik mediátor, az OspE (outer surface protein), ami kapcsolatba lép az integrinhez kötött kináz enzimmel és meggátolja az epithel sejtek leválását (ILK1, 2, integrin linked kinase 1, 2, 59 kDa serine/threonine-protein kinase, az extracelluláris mátrix szignálok az integrineken keresztül történő közvetítésében szereplő kináz enzim, 11p15.4, 7 142 bp, 452 AA, 51419 Da, 639 fehérje kapcsolat, 92 SNP, www.genecards.org. ).

Az apoptozist az IpgD gátolja meg, a PI3K (phosphatydil inositol 3 kinase) és a PKB/AKT (protein kináz B/ v-akt murine thymoma viral oncogene homolog 1, az AKT1 és AKT2 rokon szerin/threonin, plectstrin homológ domainnel rendelkező kináz enzimek /plazma membrán kapcsolatot létesítő domain, foszfatidil inozitol lipidekhez kapcsolódik/, foszforilációval aktiválódnak /Ser308, Thr478/, részt vesznek receptor jelátviteli folyamatok közvetítésében /pl. inzulin receptor, növekedési faktor receptorok/, szabályozzák a sejtek túlélését, az angiogenezist, a daganatok kialakulását. 14q32.32-q32.33, 26 395 bp, 480 AA, 55686 Da, 312 fehérje kapcsolat, 392 SNP, www.genecards.org.) aktiválása révén. Ez a folyamat a sejtek túlélését idézi elő. Végeredményben az enteroinvasiv törzsek számára replikatív fészek alakul ki, amelyben a baktériumok proliferálnak. A baktériumoknak a colonocitákon belüli túléléshez el kell kerülniük a veleszületett immunapparátus válaszrekacióját. Ebben négy különböző effektor molekula együttes hatása játszik közre.

Az egyik fehérje az OspG. Ez kötődik az ubiquitálódott E2 fehérjékhez, így a NFkB (nukleáris faktor kappa B), inhibitor alegységéhez, az IkB (inhibitor kappa B) alfához (NFKBIA, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor alpha. Az NFKB komplexeket az NFKBIA vagy az NFKBIB inhibitorok a citoplazmában inaktiválják. Az inhibitorokat az aktíváció során serin foszforiláció révén az IKBKA és IKBKB kinázok ubiquitinációs degradáló útra irányítják. NFKBIA: 14q13, 3 245 bp, 317 AA, 35 609 Da, 202 fehérje kapcsolat, 134 SNP, www.genecards.org.). A nukleáris faktor kappa-light-chain-enhancer of activated B cells (NFkappaB) a citoplazmában aktiválódó, ezt követően a magba kerülő, dimer transzkripciós faktor proteinkomplex. Az immunválasz alapvető szabályozója a fertőzések fellépése során (felfedezője David Baltimore, Nobel díj, 1975). Az NFKB1 (p50), az NFKB2 (p52) proteinek homo-, illetve heterodimer komplexeket képezhetnek, az utóbbi esetben kapcsolódnak a RELA (p65), vagy a REL B (p105) fehérjékkel (V-rel reticuloendotheliosis viral oncogene homolog /avian/ protoonkogén protein család, a c/cellular/Rel a B sejtek túlélést segíti elő B sejtes limfomákban, Hodgkin kórban). A különböző dimer kombinációk aktivátorként vagy represszorként működnek. A komplexeket a citoplazmában az NFkappaB inhibitor család tagjai (inhibitor kappa B /A, B/) inaktív állapotban tartják. Az aktiváció során az IkappaB kinázok (IKK) általi foszforiláció után az inhibitor disszociál és degradálódik, a nukleáris lokalizációs szignál szabaddá válik és a transzkripciós faktor komplex a magba kerül (NFKB1, 105 kD prekurzor proteint kódol, amelyből az 50 kD-s protein változat képződik. A 105 kD-s fehérje transzkripcionális inhibitor, az 50 kD-s fehérje az NFkB komplex része. A p50 az 5’-GGNNYYCC-3’ konszenzus szekvenciához kötődik, amely az immunválasz, az akut fázis reakció génjeit aktiválja.  4q24, 115974 bp, 968 AA, 15536 Da, 2 fehérje izoform, 389 fehérje kapcsolat, 1422 SNP, www.genecards.org.).

Az OspF a sejtmagban irreverzibilisen defoszforilálja a MAPK-kat, amelyek szükségesek az NFkB-t reguláló gének átíródásához (mitogén aktivált protein kinázok, számos biológiai szignál integrálását végző szerin/threonin kináz enzim rendszer, aktivációjuk foszforilációval cascade szerűen zajlik, a MAPKKK, majd MAPKK enzimek aktivációja indítja el működésüket. Hat csoportba sorolódnak, extracelluláris szignál-regulált kinázok /ERK1,2, extracellular signal-regulated kinase, növekedési faktorok jelátvitele/, c-jun N-terminális kinázok /JNK, c-jun N-terminal kinases, vagy stress aktívált protein kinázok, stress activated protein kinase, SAPK/, p38 isoformok /alfa, béta, gamma, delta, MAPK11, 12, 13, 14,  UV sugárzás, ozmotikus hatás, gyulladásos citokinek, bakteriális LPS aktiválja/, ERK 3 /MAPK6/, ERK 4 /MAPK4/, ERK 7/8 /MAPK15/. Számos folyamatot szabályoznak, növekedési faktorok, hormonok jelátvitelét, transzkripció szabályozást, sejtproliferációt, differenciálódást. Nem megfelelően szabályozott működésük szerepel a carcinogenezis /ERK/, neurodegeneratív betegségek /JNK/ és gyulladásos kórképek /p38/ pathomechanizmusában).

Az IpaH a sejtmagban splicing faktorokkal lép kapcsolatba. Ezek érintettek a gyulladásos citokinek expressziójában. Az OspB, kölcsönhatásban az OspF-vel csökkenti az IL-8 (interleukin- 8) termelődését (az IL-8 a CXC chemokin család egyik ligand tagja, chemotactikus /neutrofil, bazofil, T sejtek/ és angiogenetikus fehérje, az egyik alapvető gyulladásos mediátor, 4q13-q21, 3211 bp, 99 AA, 11098 Da, 2 fehérje isoform, 84 fehérje kapcsolat, 101 SNP, www.genecards.org.), és gátolja a kromatin remodellingben résztvevő gazdasejt faktorok toborzását. A négy effektor mechanizmus együttesen csökkenti a gyulladásos választ és hozzájárul a kórokozók perzisztálásához.

A Shigelláknak nincs flagelluma és a sejten belüli, illetve a sejtről-sejtre történő terjedéshez szükséges a sejt mozgató apparátusának manipulációja. A külső membrán protein VirG/IcsA (intracellular spread gene A) a baktérium egyik pólusán lokalizálódik. A fehérje toborozza és aktiválja a NWASP/ ARP2,3 komplexet, amely elindítja az aktin polimerizációját. A polimerizálódó aktin filamentumok keresztültolják a baktériumokat a sejten. A VirA mikrotubulusokat destabilizáló hatása fontos szerepet játszik a Shigellák és az EIEC törzsek intracellularis terjedésében, csatornát biztosítva számukra a sejten belül. A gazdasejtek védekező rendszerének része az autofágia. Az autofágia protein 5 (Atg5) fehérje (ATG5 gene, autophagy related 5 homolog /S. cerevisiae/, az autofágia irányításában, az apoptózis caspase aktiváció utáni eseményeiben résztvevő fehérjecsalád /ATG1-16/ egyik tagja, 6q21, 141 345 bp, 275 AA, 32447 Da, 2 protein isoform, 640 fehérje kapcsolat, 1615 SNP, www.genecards.org. ) kapcsolódása a baktériumok VirG fehérjéjéhez elindítja az autofágia folyamatát. Az IcsB bakteriális protein azonban a VirG-hez kötődve megakadályozza az Atg5 kapcsolódását és az autofágia elindulását.

ETEC törzsek patomechanizmusa

Az ETEC törzsek csecsemőkori vízszerű hasmenést, utazók hasmenését (traveller’s diarrhoe) okozzák, jelentős gyulladás és láz nélkül. A törzs nem invazív tulajdonságú. Labilis és / vagy stabil toxint termel, fimbriális adhezinjei a CFA 1, CFA2 és K88, K99.

A többi E. coli törzstől abban különbözik, hogy hőlabilis (LT, labil toxin) és hőstabil (ST, stabil enterotoxin) toxint termel. Egyes ETEC törzsek csak LT-t, vagy csak ST-t termelnek, mások mindkettőt. A törzsek által expresszált kolonizációs faktorok (CF) közvetítik a baktériumok tapadását a bél mucosalis felszínéhez. Ez centrális lépése az ETEC törzsek virulenciájának.

Az ETEC törzseket először a malacok halálos kimenetelű hasmenésének kórokozójaként írták le. A későbbiekben felismerték, hogy két klinikai szindróma fő kórokozói, a csecsemőkori, elválasztás időszakában kialakuló hasmenésé (a fejlődő országokban), valamint az utazók hasmenéséé. Az ETEC fertőzések során az exponált egyénekben mucosalis immunitás alakul ki. A tünetmentes fertőzés során az immunitással rendelkező egyének is üríthetnek nagy mennyiségű virulens baktériumot a székletben. A fertőzés kialakulása magas fertőző kórokozó dózishoz kötött (108 cfu, colony forming unit). Az endémiás területeken a fertőzés gyakorisága rendkívűl nagyfokú és az anyatejes táplálásról való elválasztás után alakul ki. Ebben az életkorban fordulnak elő a halálllal járó esetek. Az ETEC által okozott fertőzések gyakorisága az endémiás területeken 10-30%. Az iskoláskorú gyermekek és felnőttek között a fertőzés előfordulása rendkívűl alacsony. Az epidemiológiai vizsgálatok azt mutatták, hogy a fertőzés kontaminált élelmiszerekkel és vízzel terjed. Emberről emberre való terjedést önkéntesek ETEC-vel való fertőzése során nem észleltek. Az ETEC fertőzésekre fogékonyak az immunológiai szempontból naív felnőttek is (szemben az EPEC fertőzésekkel). Az ETEC fertőzések domináns kóroki tényezői a fejlett országokból az endémiás területre látogató utazók hasmenésének. Az utazók 20-60%-a fertőződik a kórokozóval. Az utazók hasmenésének leggyakoribb évszaki előfordulása a meleg és a nedves hónapok. A klinikai lefolyás 14-50 órás lappangási periódus után hirtelen kialakuló vizes hasmenés, ez rendszerint nem véres, nem tartalmaz nyákot vagy gennyet. A fertőzött egyének kis részében láz és hányás is jelen van. A hasmenés többnyire nem súlyos, időtartama rövid és magától megszűnik, de néha lehet súlyos is hasonlóan a V. cholerae fertőzéshez. Antibiotikus kezelés megrövidíti mind a hasmenés időtartamát, mind a baktérium ürítés időszakát. Sajnálatosan az endémiás területek nagy részén nem áll rendelkezésre hozzáférhető hatásos antibiotikum. Az ETEC törzsekben is egyre jelentősebb az antibiotikum rezisztencia.

Az ETEC törzsek virulencia tényezői

Az ETEC törzsek a vékonybél epithel sejteivel kapcsolódnak kolonizációs faktoraik (CFcolonization factor) révén. A CF-k lehetnek fimbriálisak, nem fimbriálisak, helikálisak és fibrillálisak. A nagyszámú azonosított CF közül a leggyakoribb a CFA/1, 2, 4. Receptoraikat jelenleg részleteiben nem ismerjük. A CFA1 esetében az enterociták membránjában nem acidikus glikoszfingolipidek és glikoproteinek szénhidrát oldalláncai, a CFA4 esetén pedig acidikus glikoszfingolipid szulfatidok. Újabban kimutatták, hogy az EtpA (ETEC two-partner secretion locus által kódolt adhezin) szekretált adhezin átmenetileg kötődik a flagellumok csúcsi részére és epithelialis sejt adherencia faktor szerepet tölt be. Mind a CF, mind a flagellum részt vesz az ETEC gazdasejthez való kezdeti kapcsolódásában, de a szoros kapcsolat kialakításában a Tia és a TibA külső membrán proteinek vesznek részt. Az ETEC által okozott hasmenés kialakuláslában a hőstabil (ST: stabil toxin) és a hőlabilis (LT: labil toxin) enterotoxinok, illetve kombinációjuk szerepe kulcsfontosságú. Az ST-k kis molekulatömegű toxinok, két alosztályuk az STa és STb 72 aminosavas prekurzorként szintetizálódik. Az STa 18-19 aminósavból, az STb 48 aminósavból áll. Az STa a kefeszegélyben a guanyl cyclase receptorhoz kötődik és aktivitását stimulálja. A folyamat az intracellularis cGMP szint emelkedését okozza, amely aktiválja a cysticus fibrosis transzmembrán conductance regulator (CFTR) ioncsatornát (cystic fibrosis transmembrane conductance regulator ATP-binding cassette, szinonímák: ABCC7, ABC35, ATP-binding cassette /ABC/ transporter család /7 tagú, ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White/, ezen belül az MRP /ABCC11, Multidrug Resistance-associated Protein 8/ alcsalád tagja, membrán transzporter fehérjék, a CFTR klór csatorna és más transzport utakat is szabályoz, 7q31.2,  202 882 bp, 1480 AA, 168 142 Da, 3 protein isoform, 182 fehérje kapcsolat, 2267 SNP, sok mutációja cisztás fibrózis kialakulásához vezet,www.genecards.org.). Ez következményesen károsítja a Na+ absorpciót és fokozott vízkiáramlást okoz a béllumenbe. Az LT hasonló a cholera toxinhoz, AB5 típusú toxin. A baktérium sejt felszínén egy nyúlványból szekretálódik és a gazdasejt felszíni lipopoliszaccharidhoz kapcsolódik. Adhezinként működik, megkönnyíti a baktérium sejt tapadását a gazdasejthez. Az LT B alegysége monoszialoglikozid GM1-vel kapcsolódik a sejtfelszínen, lipid raftokon internalizálódik, majd az endoplazmás retikulumon át a cytosolba jut. Az A alegység ADP ribozilációt okoz a stimulátoros guanin nukleotid kötő G protein alfa alegységén. Ez aktiválja az adenilcikláz enzimet, ami növeli az intracellularis cAMP szintet. Ez következményesen aktiválja a cAMP dependens protein kinase A-t, amely azután aktiválja a CFTR-t. A PKA aktiváció gátolja az antimikrobiális peptidek expresszióját is. A protein kinase A, a PRKACB protein kinase cAMP-dependent catalytic beta, a G proteinnel kapcsolt receptorok cAMP függő szignál továbbítását végzi, szabályozza a sejtproliferációt, a sejtciklust, sejtdifferenciálódást, microtubulus dinamikát, kromatin kondenzációt, intracellularis transzportot, ionáramlást. 1p31.1, 160437 bp, 351 AA, 40 623 Da, 8 protein isoform, 155 fehérje kapcsolat, 1706 SNP (www.genecards.org.) .

Az ETEC törzsek egyéb virulencia faktorai a következők:

EatA (ETEC autotransporter A), szerin proteáz autotranszporter enzim (SPATE), amely hasítja a catepsin B-t és növeli a béllumenben a folyadékmennyiség emelkedését.

A cylA pórusképző citotoxin.

Az St1 vagy East1 hasonló funkciójú, mint az STa.

Adherencia faktorok

Adhezív fimbriák: vonatkozó gének cfaI, cofA, cooA, cs3, cs5, csbA, cseA, csnA, cssA, csvA, cswA.

A baktériumok adherenciáját különféle proteinekből felépülő felszíni struktúrák közvetítik. Ezeket colonizációs faktoroknak (CF), colonizációs faktor antigéneknek (CFA), coli surface antigéneknek (CSA) illetve putatív colonizácios faktoroknak (PCF) nevezik. A colonisatios faktorokat struktúrájuk alapján fimbriákra és fibrillumokra osztják. A fimbriális CF-k rigid filamentozus, rúdhoz hasonló struktúrák, a fibrilláris CF-k vékonyabbak, flexibilisek, kevesebb alegységük van. Funkcionális szempontból adhezinek, receptoraik glikolipidek, glikoproteinek oligoszacharid komponensei.

Az ETEC törzsek gazdasepcifikusak, a gazdaspecifitást a colonizácios faktorok közvetítik. A humán ETEC törzsekben 21 különböző colonizációs faktort azonosítottak. Az emberi ETEC törzsek 75%-a expresszál vagy CFA/I, CFA/II, vagy CFA/IV-t. A különféle állati sepcifitást mutató ETEC törzsek szintén különböző colonisatios faktorokat termelnek. Ezek különböznek a humán specifikus izolátumoktól. Az ETEC törzsek többféle plazmidot hordoznak. A CF colonisatios faktorokat kódoló gének plazmidokon találhatók. 

Toxinok

Hőlabilis toxin (LT, labil toxin): intracellularisan ható A-B típusú, ADP-ribozil transferase aktivitású protein. Vonatkozó gének: eltA, eltB. II-s típusú szekréciós rendszeren keresztül szekretálódnak az extracellularis térbe. Biológiai és kémiai tulajdonságok alapján 2 altípust, az LT1 és LT2-t különítettek el. Az LT-k plazmidon kódoltak. Az LT2 általában állatokban fordul elő, és két variánsát ismerték meg, at LT2A és LT2B-t. Aminosav szekvencia alapján 16 LT altípust definiáltak. A két fő altípus antigenetikusan különbözik. Struktúrálisan és funkcionálisan hasonlóak a cholera enterotoxinhoz. Az LT1 A és B alegységekből áll, a B alegység a GM1 gangliozidhoz kötődik a gazdasejt membránján. Az A alegység A1 és A2 proteolitikusan elválasztott alegységekből áll, amelyeket diszulfidkötés kapcsol össze. Az A1 peptid enzimatikusan aktív, ADP ribozil transferase aktivitást mutat. Az A alegység az LT2 toxinban is azonos funkciójú, mint az LT1-ben.  Az LT2A B alegysége a GD1B gangliozidhoz, az LT-2B toxin esetében a GD1A gangliozidhoz kötődik. Funkcionális szempontból ADP ribozilációt és adenilcikláz aktivációt okoznak, amely ionszekréciót eredményez és szerepet játszik a hasmenés kialakulásában.

A toxin hatásmechanizmusa a következő: a toxin átviszi a NAD-ról az ADP ribózt a stimulátoros GTP alfa alegységének 201-s pozíciójú argininjére, blokkolva ezzel az alegység GTP-ase aktivitását. Ennek következtében az adenilcikláz permanensen aktív állapotba kerül, ami megemelkedett intracellularis c-AMP koncentrációt eredményez. Az emelkedett c-AMP szint a c-AMP dependens protein kináz PKA (protein kináz A) aktiválódását okozza. A PKA foszforilálja az intestinalis epithelsejtek apicalis membránjának ioncsatornáit. Itt az elsődleges célpont a CFTR csatorna. A csatorna aktiválódása fokozott  Cl- szekrécióhoz vezet az intestinalis crypták sejtjeiből és csökken a Na+ és a Cl- absorpciója a bélsejtek villusain.

Hőstabil toxin (ST, stabil toxin): vonatkozó gén sta. Membránon ható guanilát cikláz aktiváló toxin. Egy peptidből álló kisméretű toxin. Két, egymással nem rokon osztálya létezik, az STa és STb. A két toxin alosztály egymástól struktúrálisan és funkcionálisan is különbözik. Emberi betegséggel csak az STa kapcsolatos, az STb állati betegségek patomechanizmusában szerepel.

Az STa toxin 18 vagy 19 aminosavból álló, 2 kD peptid, 6 cystein aminosav és 3 intramolekuláris diszulfid híd található a peptidben. A három diszulfid kötés alapvető a hőstabilitás és a biológiai aktivitás szempontjából. Az STb toxin 48 aminosavat és két diszulfidkötést tartalmaz. Az STa a membrán guanilát ciklázt aktiválja, ami következményesen ionszekréciót okoz. Az STb az intracellularis kálcium szintet növeli. Ez szintén ionszekréció fokozódáshoz vezet.

A toxinok hatásmechanizmusa a következő: az STa a guanilát cikláz C extracellularis ligand domainjével kapcsolódik az intestinalis epithel sejtek kefeszegélyének membránjában, amely a guanilát cikláz aktivitás növekedéséhez vezet. Ez növeli az intracellularis GMP szintet. Ennek következtében a sejtek villosus csúcsán gátlódik a Na+ és Cl- felszívódás, a Cl- szekréció pedig stimulálódik az intestinalis crypták sejteiben, a CFTR aktivációja következtében.  A folyamatokban szerepet játszanak a c-GMP és c-AMP dependens kinázok.

Az STb intestinalis receptorát még nem azonosították. Az STb kapcsolódása a bélsejtekhez szerotonin felszabadulást, PGE2 termelést és megnövekedett cytosol Ca2+ koncentrációt okoz.

Az LT hatása 15-60 perc után érvényesül, az ST hatása sokkal gyorsabb, ami azzal magyarázható, hogy az LT a basolateralis adenylat cikláz komplexen hat, az ST pedig az apikalis cikláz receptoron.

NMEC (neonatalis meningitist okozó  E. coli) törzsek patomechanizmusa

A neonatalis E. coli meningitisből izolált törzsek között a K1 kapszuláris poliszaccharidot tartalmazó E. coli törzsek domináns előfordulásúak (több mint 80%). A K1 poliszaccharidot tartalmazó törzsek O szerotípusa limitált, O18, O7, O1 típus fordul elő közöttük a leggyakrabban. A fertőződés útja orális. Bélkolonizáció jön létre, a baktérium transzlokálódik és disszeminálódik, bacteriaemia következik be és a baktérium penetrálja a vér-agy gátat. A K1 E coli baktériumok zipzár mechanizmussal az agy mikrovasularis endothel sejtjeibe jutnak be, majd vacuolumokba bezárt állapotban, intracellularis szaporodás nélkül átvándorolnak az agyi mikrovascularis endothel sejteken. Az NMEC törzsek virulencia faktorai: adherencia tényezők: S fimbria, invazív tényezők: AslA , Ibes K1, OmpA, TraJ, toxin : Cnf1.

A NMEC törzsek a gastrointestinalis traktusban gyakran előforduló baktériumok. A leggyakoribb kóroki tényezői az újszülöttek Gram negatív baktérium asszociált meningitisének. A halálozási ráta 40%, a túlélőknek gyakran súlyos neurológiai maradványtünetei vannak. Az NMEC pathogenezise komplex. A baktériumnak a bélrendszerből be kell hatolnia a keringésbe, át kell jutnia a vér-agy gáton és be kell kerülnie a központi idegrendszerbe. A meningealis gyulladás és a liquorban megfigyelhető pleiocytosis a betegség alapvető tünetei. A kezdeti bakteriális kolonizáció az anyai akviráció következtében jön létre, amelyet az enterocitákon keresztül létrejövő transzcitózis és a baktérium véráramba kerülése követ. A betegség progressziója a bakteriémia fokától függ, melyet a baktériumok vérben történő túlélése határoz meg. A gazda immunrendszerével szembeni védelmet az antifagocita hatású tok biztosítja, amely polisziálsav homopolimer. A tok serum rezisztenciát eredményez, amely a baktérium ellenálló képességét teszi lehetővé a vér különböző károsító tényezőivel, pl. a complement rendszerrrel szemben. Gátolja a fagocitózist, valamint a központi idegrendszerben a dendritikus sejtek érését. A baktérium külső membrán proteinje, az OmpA, gátolja a klasszikus komplement utat. A NMEC törzsek kapcsolatba lépnek a szervezet immunsejtejeivel, behatolnak a makrofágokba, monocitákba, ahol egyrészt gátolják az immunsejtek apoptozisát, másrészt akadályozzák a sejtek citokin termelését. A sejtek belseje replikációs térül szolgál a baktériumok számára. Újabban a NMEC törzsekben egy lambdoid fágot találtak, amely O-acil transzferáz aktivitású fehérjét kódol. Ez az O antigén acilálásával tok diverzitást eredményez, elrejtve a baktériumokat  a gazdaszervezet védekező rendszere elől. A vér-agy gát zárt határréteg, amelyet az agy microvascularis endothel sejtei alakítanak ki. A NMEC törzsek az agy microvascularis endothel sejtjeihez az 1-es típusú pílusok csúcsán lévő FimH révén kapcsolódnak a sejtfelszíni CD48-hoz (CD48, szinonímák:  Leukocyte antigen MEM-102, BCM1, B-lymphocyte activation marker BLAST-1, B-cell membrane protein, az immunglobulin szupercsalád tagja, sejtfelszíni GPI horgonnyal rögzült adhéziós molekula, a CD2-vel kapcsolódik, aktívált limfociták felszínén a sejtkapcsolatokat segíti. 1q21.3-q22, 33 106 bp, 243 AA, 27683 Da, 11 fehérje kapcsolat, 622 SNP, www.genecards.org), és az OmpA révén az ECGP96 (endothelial cell glycoprotein 96) struktúrához (HSP90B1 heat shock protein 90kDa beta /Grp94/ member 1, 12q24.2-q24.3, 23 539 bp, 803 AA, 92469 Da, 890 fehérje kapcsolat, 302 SNP, www.genecards.org). Az invázió kombinált virulenca faktorok hatására következik be. Ezek az Ibe, a FimH, az OmpA és a CNF1 (cytotoxic necrotizing factor 1). Az Ibe (invasion of brain endothelial cells) receptora ismeretlen, a CNF1 receptora a 67 kD-s laminin receptor (korábban 67LR, jelenleg RPSA gene, ribosomal protein SA, szinonímák: laminin receptor 1, Colon carcinoma laminin-binding protein, Multidrug resistance-associated protein MGr1-Ag, 67 kDa laminin receptor. A laminin non-collagén extracelluláris matrix protein, sejtadhéziót, differenciálódást, migrációt, bazális membránhoz való kapcsolódást irányít, szerepet játszik a metasztázisok kialakulásában. A nem integrin RPSA/67LR/ receptor a laminin kötés mellett receptorként szolgál prion fehérjék, vírusok és baktériumok számára. A fehérje szerepel a 40 S, kisebb riboszóma alegység stabilizációjában, a 20 S rRNS prekurzor processzálásában. A protein monomer (37LRP) és homodimer változatban (67LR) fordul elő. Az érett riboszóma 40S alegysége mintegy 33 fehérjét és egy molekula 18 S RNS-t, a nagy, 60S alegység 49 fehérjét és három RNS molekulát (28S, 5.8S és 5S) tartalmaz. A protein lokalizációja 3p22.2, 5 854 bp, 295 AA, 32854 Da, 186 fehérje kapcsolat, 203 SNP, www.genecards.org.).

A CNF bekerülve az agyi microvascularis endothel sejtekbe deaminálja a Rho GPT-ase-t, amely a myosin átrendeződés irányítója. Az endothel sejtekbe jutáshoz a FimH és az OmpA közvetítette tapadás szükséges, majd ezt követi a CNF1 gazdasejtbe történő transzlokációja. A baktériumok adherenciája előidézi az intracellularis calcium stimuláció révén az adherencia területén az aktin átrendeződést, amely a CNF1 stimulálta myosin átrendeződéssel együtt elősegíti a NMEC inváziót. A K1 tok, mely a NMEC izolátumok 80%-ban megtalálható, megakadályozza a lizoszómákkal történő fúziót és elősegíti a baktériumok áthaladását a vér-agy gáton.

NMEC virulancia tényezői

Adherencia faktorok

S fimbriák (sialyloligosaccharid kötő fimbriák): vonatkozó gén sfaA. Az adherenciában szerepet játszó fimbriák egy fő alegységből (SfaA) és minor alegységekből (SfaG, S, H) épülnek fel. Az SfaS az S fimbriák csúcsi részén lokalizált. Az S fimbriákon két kötő domaint azonosítottak. A SfaS adhezin a BMEC (brain microvascular endothelial cell) /PNEC (pulmonary neuroendocrine) sialo-glicoproteinhez, a másik kötőhely az SfaA területén a BMEC szulfatált glicolipidhez kapcsolódik.

Felvetődött a fibronectin szerepe is az S fimbriák adheziós célpontjaként.

Invázió

As1A: vonatkozó gén as1A, az aryl szulfatáz család tagja, konzervatív szulfatáz motívumot tartalmaz, de nem mutat aryl szulfatáz aktivitást. 52 kD-s protein, két transzmembrán domainje van és N terminális szignál szekvenciát tartalmaz. Ismeretlen mechanizmussal elősegíti az E. coli K1 sejtek BMEC invázióját. A K1 sejtek As1A proteinje homológ a K12  E. coli sejtek As1A fehérjéjével.

Ibe: invasion of brain endothelial cells, vonatkozó gének ibeA, B, C. Az IbeA az E. coli K1 törzsre jellemző, az IbeB és C megtalálható a K12 törzsben, p77211 és yijP fehérjékkel homológ. Az IbeA és B a külső membránban található proteinek, három illetve két transzmembrán domaint tartalmaznak, az IbeC szignál peptid szekvenciát és 6 transzmembrán szegmentumot tartalmaz az N terminális részen. Elősegítik a NMEC törzsek BMEC invázióját ligand-receptor interakció révén. Ennek pontos mechanizmusa nem tisztázott.

K1: tok, vonatkozó gének kpsD, M, T. A K1 tok poliszacharid, a NMEC törzsekre jellemző, az izolátumok 80%-ban jelen van. A tok alfa-2,8-kapcsolt sziálsav polimer (polySia), amelyet a kps géncluster kódol. Ez három funkcionális régióra osztható. A centrális elhelyezkedésű kettes régió kódolja az adott poliszacharida antigént, és a kódoló gén felelős az adott K antigén specifikus szerotípusának kialakításáért. Az egyes és hármas génrégiók konzervatív szerkezetűek és a különböző szerotípusú tokokat szintetizáló E. coli törzsek között közösek. A cluster első régiójában hat gén, a KpsF, E, D, U, C, S, a hármas régióban két gén, a Kps M, T, található. Ezen régiók géntermékei szükségesek a kapszuláris poliszacharid citoplazma membránon keresztül történő transzportjához (KpsM, T) és a sejtfelszínen való felépüléshez (KpsD, E). A kapszularis poliszacharid fagocitózist gátló és invazív sajátságot is kölcsönöz a NMEC törzsek számára. Szabályozza a NMEC tartalmú vakuolumok haladását és növeli a baktériumok intracellularis túlélését a BMEC-ben.

OmpA:  outer membran protein A, vonatkozó gén ompA. Az E. coli törzsek fő külső membrán fehérjéje, homológiát mutat a Neisseria törzsek Opa fehérjéivel. A proteinek fokozzák a törzsek invazivitását és ellenállóvá teszik a baktériumokat a vér szérum baktericid hatásával szemben. A protein N terminális domainjében a membránt nyolcszor antiparalell módon átívelő béta lánc található, közöttük négy nagy hidrofil, a baktérium sejt felszínén megjelenő hurokkal. Ezek a felszíni hurkok járulnak hozzá az E. coli K1 törzsek BMEC inváziójához. Az OmpA protein kapcsolódik a BMEC törzsek  felszínén lévő 95 kD-s ECGP (sejtfelszíni, hősokk proteinekhez hasonló glikoprotein, endothelial cell glycoprotein 96, GP96) receptorral. Az ECPG az emberi agy microvascularis endothel sejtjeinek felszínén található, a nem agyi endothel sejteken nincs jelen. Az interakció a GlcNAc1,4-GlcNac epitópokon, valamint a receptor protein vázán keresztül jön létre. Az OmpA kapcsolódása a receptorral a kapcsolódás helyén aktin kondenzációt eredményez. Az aktin reorganizáció a különféle gazda fehérjéket érintő szignalizációs mechanizmusokkal jön létre, amelyek között szerepel a fokális adhaesios kináz (PTK2, FAK, focal adhesion kinase 1, citoplazmikus, non-receptor protein tirozin kináz, a fokális adhézió területén koncentrálódik, sejtmotilitás, proliferáció, apoptózis szabályozásban vesz részt, 8q24.3, 344 317 bp, 1052 AA, 119233 Da, 4 protein isoform, 225 fehérje kapcsolat, 4004 SNP, www.genecards.org), foszfatidil-inozitol 3 kináz(ok) (PI3-kináz, sok féle enzim, 85, 55 vagy 50 kDa reguláló egységből és 110 kDa katalitikus egységből felépülő lipid kinázok, amely SH2 domainjével kapcsolódik a tirozin foszforilált fehérjékhez /pl. IRS 1-4, inzulin receptor szubsztrátok/ és a szabályozó alegység adaptorként membránközeli állapotba hozza a katalitikus egységet, amely foszforilálja a membrán foszfolipidek foszfatidil-inozitol gyűrűjének 3'OH maradékait. A PI 3-kinázok 3 osztályba sorolódnak. Az I osztály enzimei heterodimerek, reguláló és katalitikus egységekből épülnek fel, az IA osztály 110 kDa katalitikus alegységei  alfa, béta és delta változatok, az IB osztályé pedig a gamma változat. Az enzimek szerepelnek az inzulin jelátvitel glukóz felvételt szabályozó folyamatában. Részt vesznek továbbá a sejtproliferáció, sejtmigráció, degranuláció, vesiculáris mozgás és a sejt túlélésének szabályozásában.

A II. osztály enzimei homomerek (C2alpha, beta és gamma változatok). A III. osztályba csak egy enzim tartozik (Vps34p), amely a nutriensek érzékelésében és a protein kiválogatásban szerepel, a protein kináz C (PKC) alfa (a PKC enzimek szerin/threonin specifikus kináz enzimcsalád, kálcium és diacylglycerol hatására aktiálódnak. A klasszikus PKC-k /cPKC, alfa,

Béta I, II és gamma() foszfatidilszerin hatására aktiválódnak kálcium függően és diacylglycerolt (DAG) kötnek. Az új PKC-k nem kálcium függők (nPKCs epsilon, delta-, theta és eta izotípusok). Az atípusos PKC-k (aPKCs iota és zeta) nem érzékenyek kálciumra, sem DAG-ra. Számos jelátviteli útban és sejtfolyamatban részt vesznek) és caveolin 1 (CAV1,

A caveolin 1 és 2 a caveolák membránjában stabil homooligomer komplexet képező strukturális fehérjék. Membrán receptorokat, pl. integrineket, inzulin receptort, T sejt receptort kapcsolnak kináz enzimekhez, jelátviteli folyamatokban szerepelnek, sejtciklus progressziót szabályznak. 7q31.1, 36 401 bp, 178 AA, 20472 Da, 2 fehérje isoform, 151 fehérje kapcsolat, 549 SNP,www.genecards.org).

Az OmpA kötődik a C4b (aktíválódott complement C4 nagy fragmens) kötő proteinhez is, elkerülve a complement aktiváció okozta bakteriális károsítást (complement component 4 binding protein, beta, C4BP, kötődik a C3b/C4b inactivatorhoz (C3bINA), amely azután hidrolizálja a C4b-t. Gyorsítja a C4bC2a komplex, a C3 convertase degradálódását a C2a disszociálása révén, kötődik a protein S-hez és a szérum amyloid P-hez. 1q32, 11 152 bp, 252 AA, 28357 Da, 2 fehérje isoform, 8 fehérje kapcsolat, 214 SNP,www.genecards.org).

TraJ(plasmid DNA transfer (tra) gének): vonatkozó gén traj. Az F-szerű plazmid R1-19 transzfer régiójának génclusterében található tra (transfer) operon része. A bakteriális konjugációs rendszer egyik komponensével homológ. Elősegíti az E. coli K1 törzsek központi idegrendszeri invázióját és a meningitis kialakulását újszülöttekben. A TraJ hozzájárul az E. coli K1 törzsek orális fertőződést követő korai szisztémás disszeminációjához. Specifikus TraJ függő, makrofágokhoz történő kapcsolódás révén elősegíti a baktériumok makrofág sejtekbe történő hatékony bejutását. A fagocita sejtek intracellularis környezete protektív helyet biztosít a gazdaszervezet inflammatórikus védekező rendszerével szemben és elősegíti a kórokozók disszeminációját és az idegrendszerbe való bejutást.

Toxinok

CNF1: cytotoxic necrotizing factor 1, vonatkozó gén cnf1. Intracellularisan ható, inváziót elősegítő deamidase enzim aktivitású toxin. Mind a NMEC, mind az UPEC törzsek expresszálják. Nagyméretű, egyedi jellegzetességeket mutató citotoxin, ami a Rho GTP-ase folyamatos aktivációját idézi elő. Két altípusa, a CNF1 és CNF2 ismert. 1014 aminósavból áll, és a két altípus aminósav maradékainak 90%-a azonos, azonos a katalítikus aktivitásuk is. A CNF1 kromoszómán kódolt, a CNF2 pedig a pVir plazmidon. A 113 kD-s, egy láncból álló toxin molekula N terminális részén található a receptor kötő hely, a C terminális részen található a katalítikus domain és a protein középső részén helyezkedik el a transzmembrán domain. A CNF1 sejtfelszíni receptora a 37 kD-s laminin receptor prekurzor (LRP). A CNF 1 receptor mediálta endocytosis révén internalizálódik, az endocyticus vesiculumokban a savas környezet hatására a katalítikus domaint a citoszolba injektálja. A C terminális domain a Rho GTP-ase-kat deamidációval aktiválja. A RhoA esetén a 63-as glutamin, a Rac1 és Cdc 42 esetén a 61-s pozíciójú glutamin az enzim célpontja, amelyeket glutaminsavvá alakít. A glutamin reziduumok alapvetőek a GTP hidrolízis szempontjából és módosulásuk folyamatos Rho GTP-ase aktivációhoz vezet, megszüntetve a Rho GTP-ase ciklikus változását a GDP kötött inaktív, és a GTP kötött aktív állapot között. A CNF kötődés a gazdasejt membránhoz aktin stressz kötegek, membrán kitüremkedések kialakulásához, valamint a sejtek nekrozisához vezet.

UPEC (Uropathogen E. coli) patomechanizmusa

Ezek a törzsek az ExpEC, azaz extraintestinalis pathogén E. coli törzsek egyik alcsoportja. Nagyméretű patogenitási szigeteket tartalmaznak, amelyek különböznek a székletből izolált coli törzsekben észleltektől. Az UPEC törzsek képesek behatolni, majd szaporodni az uroepthelialis sejtekben.

Főbb virulencia faktoraik: adherencia tényezők: Dr adhesinek, F1C fibria, P fimbria, S, fimbria, Type1 fimbria, vas transzport rendszer: aerobactin, Chu, enterobactin, IroN, proteázok: Pic, Sat, Tsh, toxinok: Cnf1, haemolysin

patogenicitási szigetek: PAII536, PAII CFT073, PAI II536, PAI III536

UPEC felelős a vizelet elvezető traktus fertőzéseinek 80%-ért (cystitis, acut pyelonephritis). Az UPEC törzsek az intestinalis traktusból kerülnek a vizelet elvezető rendszerbe, ahol peptideket és aminosavakat használnak elsődleges szénforrásként a túléléshez. A vizelet elvezető traktusban ascendálnak az urethrából a hólyagba, onnan a vesébe, amihez különleges mechanizmusok szükségesek, részben a veleszületett immunapparátus támadásának megkerülése, részben a vizelés baktériumokat eltávolító hatásának kivédése céljából.

Néhány szigorúan regulált virulencia faktor, többek között multiplex pílusok, szekretált toxinok (Sat), vacuolating autotransporter toxin (Vat), multiplex vasfelvételi rendszer és polisaccharid tok jelentik a kulcsfontosságú virulencia tényezőket. Az UPEC belépése a vizelet elvezető rendszer epithel sejtjeibe az uroeptheliumhoz történő adhezióval kezdődik. Ezt a tapadást a FimH (fimbrialis adhezin H) közvetíti, amely a fázisfüggő 1-es típusú pílusok csúcsán helyezkedik el. A FimH kötődik a glikozilált uroplakin 1A-hoz, ami a húgyhólyagban a terminálisan differenciált superficialis rétegben elhelyezkedő facetta sejtek membránjában található. A FimH az uroplakin 3A-hoz is kötődik és a kapcsolódás foszforilációs mechanizmusokat indít el, amelyek hozzájárulnak a baktériumok uroepithel sejtekbe történő bekerüléséhez, majd az uroepithel sejtek apoptozisához. Az UPEC sejtek inváziójához hozzájárul még a FimH alfa3béta1 integrinekhez való kapcsolódása, amely rac1 aktiváción keresztül aktin polimerizációt, membrán kitüremkedés kialakulását, a microtubularis rendszer destabilizációját és a baktériumok sejtbe való bekerülését eredményezi. Az internalizált baktériumok gyorsan replikálódnak és kisebb méretű biofilm szerű, intracellularis komplexeket (IBC, intracellular bacterial communities) képeznek, amelyek átmenetileg védett környezetet jelentenek számukra. Az UPEC-k kiválhatnak az IBC-ből és kiléphetnek az epithel sejtekből a hólyag lumenébe, másrészről filamentozus alakzatot felvéve hurkot képezve átléphetnek az infektált sejtből a szomszédos uroepithel sejtbe, a veleszületett immunapparátus antibakteriális támadására történő védekező reakcióként. A fertőzés során a következményes granulocyta beáramlás szöveti károsodást okoz és a levált sejtekben az IBC-k túlélhetnek, és a későbbiekben újabb sejteket fertőzhetnek meg. Az UPEC fertőzött sejtek, valamint a levált sejtek apoptozissal elpusztulnak. A haemolysin A az UPEC törzsek pórus kialakító toxinja. Szublítikus koncentrációban gátolja a PKB-AKT aktivációját, elősegítve az uroepithel sejtek exfoliációját és apoptozisát. A felszíni facettált sejtek leválása a keletkezett résen keresztűl lehetővé teszi az UPEC törzsek további invázióját (alfa3béta1 integrinen keresztül) és disszeminációját. Az invázió endocitikus vesikulumokban aktin-citoszkeleton segítségével történik. Ezekben a vesikulumokban a replikáció korlátozott és a baktériumok a mélyebb rétegekbe jutva aktin fonalak által körülvéve nyugvó intracellularis rezervoirt (QIR, quiescent intracellular reservoir) képeznek.

Az aktin burok diszrupciója gyors replikációhoz és IBC kialakulásához vezet a citoszolban, ahonnan kijutva a kórokozók újabb sejteket fertőzhetnek meg. A nyugvó állapot a sejten belüli vezikuláris rezervoirban elősegíti a kórokozók védelmét az immunapparátus támadásával szemben. Ebben az állapotban a kórokozók hosszú ideig perzisztálhatnak a hólyagban.

Az UPEC képes manipulálni az uroepithel sejtek differenciálódását. Az uroepithel turnover indukciója kiváltja a nyugvó rezervoir reaktivációját és az akut hólyag infekció recidiválását. Az uroepithelialis turnover szabályozásának befolyásolása fontos tényezője az ismétlődő húgyúti fertőzésekre való hajlamnak, valamint a hólyagrák kialakulásának. Kezeletlen húgyúti infekció ascendálhat a vesemedencébe. Az ascendáló fertőzésben szerepet játszanak az 1-es típusú pílusok és a motilitás reciprok regulációja. Azok a baktériumok, amelyek 1-es típusú pílusokat expresszálnak, kevesebb csillót tartalmaznak, mint azok, amelyek nem expresszálnak. Úgy gondolják, hogy az 1-es típusú pílusok expressziójának kikapcsolása fokozza az UPEC törzsek motilitását. A törzs motilitás fokozódása hozzájárul a hólyagból a vesébe történő felszálló fertőzések kialakulásához. A pyelonephritist okozó UPEC törzsek gyakran expresszálnak P fimbriát, amely kötődik a glikolipidek Gal alfa 1,4 Gal béta szénhidrát csoportjaihoz. Ezek a struktúrák a vese epithel sejtjeinek felszínén találhatók. Az 1-es típusú pílusok és a motilitás inverz kapcsolatához hasonlóan a P fimbriák expressziója is kevesebb flagella jelenlétével és csökkent motilitással társul. A P fimbriák és az 1-es típusú pílusok, valamint más adhéziós clusterek közötti kapcsolat szabályozza a felszíni organellumok expresszióját, amely alapvető virulencia tényező az adott kórképben (cystitis, pyelonephritis).

Adherencia faktorok

Dr adhezinek: vonatkozó gének draA, B, C, D, E, P. A Dr adhezinek a coli törzsek húgyúti infekciókat okozó képességével társulnak. Különösen gyakoriak hólyaghurut, terhességgel társuló pyelonephritis és hasmenés előfordulása esetén. A Dr család magában foglal fimbriális adhezineket, ilyen pl. a Dr haemagglutinin (O75X adhezin) és F1845, afimbriális adhezineket, ilyenek az Afa 1, 2, 3, 4, Nfa-1, Dr-2. Jelenlétük a baktériumok felszínén elősegíti a kolonizációt.

A Dr adhezinek a Dr vércsoport antigénekhez kötődnek. Ezek a Decay Accelerating Factoron (DAF, CD55) találhatók. A DAF a complement rendszer citolitikus hatását gátló protein. A Dr család adhezinjei a baktériumok felszínén hosszú cellularis extenziókként vannak jelen és kötődésük a receptorokhoz számos jelátviteli út, köztük a PI3 kináz aktiválódását idézi elő.

F1C fimbria: Hemagglutinációt nem okozó adherencia faktor. A húgyúti rendszer gyulladását okozó E. coli törzsek 14%-a, a faecalis coli izolátumok 7%-a expresszálja. Genetikailag homológ az S fimbriákkal, de a receptor specifitásuk különbözik. Glikolipidek, a sialoGM1, 2, Gal NAC béta 1-4 Gal béta szekvenciájához kötődik nagy affinitással. Járulékos, alacsony affinitású kötőhelyei a glikolipidek felszínén a Glc NAC béta 1-3 Gal béta, Gal béta 1-4 Glc.

P fimbriák (P vércsoport antigéneket kötő): a Pap pilusok környezeti és nutricionális tényezők által regulált folyamat során expresszálódnak metiláció függő mechanizmussal. A PapG alegység bináris komplexként kötődik a Gbo4 receptorhoz (globoseries of glycolipids). A kötődés az alfa-D-galactopyranozil-(1-4)-béta-D-galactopyranoside gyökön történik, amely számos glikolipidben megtalálható a felső húgyúti traktusban és az erythrocytákon. A három PapG adhezin variáns a PapG-G-I ,G-II és G-III, három különböző, de rokon szerkezetű gal-alfa (1,4) gal receptort ismer fel. A PapG kötődés a glikolipid receptorokhoz mind a baktériumokban, mind az uroepithel sejtekben specifikus változásokat indukál, ami elősegíti a baktérium virulenciáját. A baktérium sejtben aktiválódik a vas felvételi rendszer, a gazdasejtekben elindul a glikolipid receptorokról a ceramid intracellularis felszabadulása. Ez második jelátvivőként aktiválja a ceramiddal aktiválódó serin-treonin protein kinázok és foszfatázok közvetítésével az uroepithel sejtek citokin termelését, pl. a TNF alfa produkciót.

S fimbriák: az sfaS alegység az S pílus csúcsán helyezkedik el és ez közvetíti a baktérium összekapcsolódását a sziálsav maradékot tartalmazó receptorokkal. Az S fimbriák az uroplakin 3 membrán protein sziálsav maradékához kapcsolódnak.

1-es típusú fimbriák: úgynevezett mannóz érzékeny (MSHA mannóz sensitiv hemagglutination) fimbriák. A vörösvérsejtek hemagglutinációja mannóz jelenlétében meggátlódik. Az 1-es típusú fimbriákat kódoló gének nemcsak az UPEC törzsekben, hanem szinte valamennyi E coli törzsben jelen vannak. Ezek a fimbriák virulencia faktorként csak a húgyúti infekciók patogenezisében szerepelnek.

Az 1-es típusú fimbriák alapvető szerepet töltenek be a húgyhólyag epithel sejtejeinek kolonizációjában. A fimbriák hegyén elhelyezkedő fimH az az adhezin protein, amely kötődik a mannóz tartalmú glikoprotein receptorokhoz, az epithel sejtek felszínén lévő uroplakin molekulákhoz. Az uroplakinok a membránt négyszer átívelő tetraspanin család (transmembran superfamily 4) tagjai. A terminálisan differenciálódott uroepithel sejtek membránja speciális területének, az asymmetric unit membránnak konzervatív, integrális membrán proteinjei (AUM, az emlős urothelium luminalis felszíne számos membrán plakkot tartalmaz, az ún. asszimetrikus unit membránt, amely szemikristályos hexagonális 12 nm protein részecskékből áll. Ezek a plakkok stabilizálják az urothel felszínt a hólyag disztenzio során. A proteinek, szénhidrátok és lipidek megoszlása a kettős membrán rétegben aszimmetrikus.) Homo-, vagy heterodiméreket alkotnak. Szabályozzák a hólyag esernyő sejtjeinek permeábilitását, a membrán/citoszkeleton kapcsolatot (AUM assymetric unit membrane/cytosceleton), védik hólyag disztenzió esetén a sejtek apikális membránját a megrepedéstől. Részt vesznek továbbá a sejtek növekedésében és motilitásában. Szerepelnek az urothelium glycocalyx kialakításában és a baktériumok adherenciájának gátlásában. Nagyfokban termelődnek a transitionális hólyag carcinoma sejtekben. (Uroplakin 1, UPK1B, heterodimert képez az UPK3A-val vagy 3B-vel, 3q13.32, 31 637 bp, 260 AA, 29643 Da, 2 fehérje kapcsolat, 2 alternatív splice mintázat, 9 exon, 497 SNP. UPK1A, diszulfid kötött homodimer vagy heterodimer az UPK2-vel, 19q13.13, 11 653 bp, 258 AA, 28 879 Da, 238 SNP. UPK2 az UPK1A-val lép kapcsolatba, 11q23, 33 397 bp, 184 AA, 19 438 Da, 3 fehérje kapcsolat, 2 alternatív splice mintázat, 5 exon, 70 SNP. UPK3A az UPK1B-vel heterodimert képez, enélkül nem jut ki az endoplazmás retikulumból,22q13.31, 10 893 bp, 287 AA, 30670 Da, 2 protein isoform, 1 fehérje kapcsolat, 2 alternatív splice mintázat, 5 exon, 270 SNP. UPK3B az UPK1B-vel alkot heterodimert, 7q11.2, 508 596 bp, 320 AA, 33882 Da, 2 protein isoform, 1 fehérje kapcsolat, 216 SNP, www.genecards.org).

A kapcsolódást követi az uroepithel sejtekbe történő invázió (Kausar Y, Chunchanur SK, Nadagir SD, Halesh LH, Chandrasekhar MR.Virulence factors, Serotypes and Antimicrobial Suspectibility Pattern of Escherichia coli in Urinary Tract Infections. Al Ame en J Med S c i  2009, 2, 47 -51,Welch RA, Burland V, Plunkett G, Redford P, Roesch P, Rasko D, Buckles EL, Liou S-R, Boutin A, Hackett J, Stroud D, Mayhew GF, Rose DJ, Zhou S, Schwartz DC, Perna NT, Mobley HLT,

Donnenberg MS, Blattner FR. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli.  PNAS2002, 99, 17020–17024, Nataro JP, Kaper JB.Diarrheagenic Escherichia coli. Clin Microbiol Rev 1998, 11, 142-203, Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity, Nat Rev Microbiol 2010, 8, 26-38).

Vas felvételi rendszerek

Aerobactin: iucA, B, C, D, és iutA. Hydroxamát típusú siderophor, a TonB dependens vas transzport rendszer tagja (részletesen ld. később). A siderophor coli törzsekben, Shigella flexneri, K. pneumoniae törzsekben is megtalálható.

Chu: E. coli hemin uptake, vonatkozó gének chuA, S, T, U, W, X, Y. A chuA 69 kD-s külső membrán proteint kódol. A gén egy nagyobb locus, a hem transzport locus része, mely széles körben található meg patogén E. coli törzsekben. A hem és a hemoglobin vasforrásként történő felhasználása előnyös a cytotoxinokat szekretáló patogén törzsek számára, mert a szöveti invázió helyén az intracelluláris hem rezervoirokat is képesek felhasználni.

Enterobactin: vonatkozó gének: entA, B, C, D, E, F, fepA, B, C, D, E, G. Az enterobactin igen effektív vas kelátor, az Fe3+ iont 6 catechol oxigén veszi körbe és fém kelátot képez 3 negatív töltéssel. Szerkezetét tekintve 669 kD-s catecholat, amelyet az E. coli és a S. typhimurium szintetizál. A siderophor a ferri enterobactin receptor protein A-hoz kötődik (FepA) amely 724 aminósavból álló külső membrán protein, és a periplazmába transzportálja a ferri enterobactint. A többi protein Fep B, C, D, G a transzport rendszer része a citoplazmába történő továbbítás során.

IroN: vonatkozó gén iroN. Az E. coli és a Salmonella enteritica enterobactin siderophor egyik receptora és a baktériumok virulencia faktora.

Proteázok

Sat: secreted autotransporter toxin. Autotranszporter proteáz, a SPATE (serin protease autotransporter enzime) 8 tagú protein családjának tagja. Ezek a következők: Sat (UPEC), Pet (EAEC), EspC (EPEC), Pic (EAEC, Shigella), SigA (shigella), SepA (Shigella), Tsh (Avián E. coli),  EspP (EHEC).

A PAI 2 (patogenicity island) területén kódolt 107 kD-s, három domainnel rendelkező szekretált protein, vakuolizáló hatású. A vese epithelium károsodását idézi elő felső húgyúti infekciók során.

Pic: proteáz és autotranszporter (SPATE), az enteroaggregatív E. coli törzsekben  és a S. flexneri-benis termelődő, mucináz aktivitású szekretált proteáz.

Tsh: temperature sensitive hemagglutinin, autotraszporter és proteáz (SPATE), csirke vvt-ket hemagglutinál és a hemoglobint hasítja. A Tsh termelődése a madarakban halálos infekciókkal (APEC avian patogenic E. coli törzsek) jár. Az alveolusokban fibrin depozítumok jönnek létre. A Tsh a colV virulencia plazmidon kódolt.

CNF1:cytotoxic necrotizing factor 1, részletesen az NMEC virulencia faktorainál.

haemolysin: részletesen az EHEC virulencia faktorainál.

Az UPEC törzsekben négy PAI került megismerésre.

A necrotoxigén E. coli törzsek (NTEC) emberi extraintestinális fertőzésekből (ExPEC, extraintestinal pathogen E. coli), főként húgyuti kórképekből kerültek izolálásra.  Fő virulencia faktoraik a cytotoxikus necrotizáló factorok (CNF 1 és CNF 2) és a cytolethal distending toxin. A cell-detaching  E. coli (CDEC) törzsek gyermekkori hasmenést okoznak és főbb virulencia faktoraik a CNF 1 és a haemolysin. Az adherens invasiv E. coli törzsek (AIEC) 36 %-ban társulnak ileális lokalizációjú Crohn betegséggel. Ezek a baktériumok nagy affinitással kapcsolódnak a carcinoembryonicus antigen related cell adhesion molecule 6 (CEACAM6)-hoz, amelynek expressziója az ileum területén Crohn betegekben jelentősen fokozott. Az AIEC törzsek adherenciája (Afa/Dr adherencia mechanizmus) a CEACAM 6-hoz a tumor necrosis factor alfa és interferon-gamma termelés stimulációja révén fokozza a receptor expresszióját. A CEACAM 6 adherencia elősegíti továbbá az ilealis mucosa kolonizációját és a következményes krónikus gyulladásos folyamat kialakulását. Az adherencia elindítja az AIEC törzsek invazióját az intestinális epithel sejtekbe. A Crohn betegségben szenvedők gyakran nem képesek kontrollálni a bakteriális infekciót és az inváziót a veleszületett immunrendszer intracelluláris felismerő fehérjéjének, a NOD 2 proteinnek hipomorf mutációi miatt (nucleotide-binding oligomerization domain containing 2, intracelluláris felismerő fehérjecsalád tagja, a bacteriális lipopoliszaccharid, az LPS muramyl dipeptid részét ismeri fel, 16q21, 39 474 bp, 2 alternatív isoform, 1040 AA, 29 fehérje kapcsolat, 664 SNP,www.genecards.org,). Ez az autophagia defektusához vezethet, és az AIEC replikációra képes marad a sejtekben. A szaporodó baktériumok az intestinális epithel sejteken keresztül transzlokálódnak a lamina propriába. Itt a macrophag sejtekbe jutva képesek túlélni és ismételt kikerülésükkel a krónikus gyulladásos folyamatot fenntartani.

A táblázatban összefoglaljuk a pathogén coli törzsek főbb virulencia tényezőit

(Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity, Nat Rev Microbiol, 8, 26-38, 2010, Supplementary information, www.nature.com/reviews/micro alapján).

Adherencia faktorok

AAF                           EAEC

Afa–Dr                       DAEC

BFP                            EPEC

CFs                             ETEC

EtpA                           ETEC

HCP                           EHEC

Intimin                       EPEC, EHEC (SGLT1 gátlás)

OmpA                        NMEC  (klasszikus komplement út gátlás)

P fimbriae                   UPEC

Tia                              ETEC

TibA                           ETEC

1 típusú pilusok          UPEC, NMEC

Toxinok

CNF1              NMEC, UPEC           Invazivitás

CylA               ETEC                         Pórus képző cytotoxin

EAST1            EAEC, EPEC, EHEC, ETEC          STa szerű toxin

EatA               ETEC                         SPATE aktivitás, folyadék akkumuláció

HlyA               EHEC, UPEC             litikus toxin, sejthalál

LT                   ETEC  ciklikus CMP indukció, ioncsere gátlás, antimikrobiális peptid gátlás

Pet                  EAEC                         SPATE aktivitás, exfoliáció

Pic                   EAEC, EIEC, UPECSPATE és mucináz aktivitás

Sat                  DAEC, UPEC             tight junction károsítás

ShET1             EAEC, EIEC             folyadék felhalmozódás

ST                   ETEC                         ciklikus GMP indukció, ioncsere károsítás

Stx                  EHEC, EIEC   HUS,nucleolin felszini lokalizáció, sejthalál

 

T3SS effektorok

 

Cif                  EPEC, EHEC, EIEC       sejt ciklus blokk, apoptózis gátlás

EspB               EPEC, EHEC                 effektorok transzlokációja, fagocitózis    gátlás

EspF               EPEC, EHEC mitokondrium károsodás, sejthalál, tight junction károsítás, 

fagocitózis gátlás, Na-H exchange protein gátlás (NHE3), aquaporin gátlás, 

sodium-glukóz transzporter 1 gátlás

TccP                EHEC, EPEC  N-WASP aktiválás (aktin átrendeződés)

EspG               EPEC, EHEC mikrotubulus változás, aquaporin gátlás

IcsB                EIEC  VirG szekvesztráció, autophagia gátlás

IpaA               EIEC Invázió

IpaB                EIEC  makrofág sejt halál, sejt ciklus blokk, fagoszómából való kiszabadulás

IpaC                EIEC Invázió, fagoszómából való kiszabadulás

IpaD               EIEC Escape from phagosomes

IpaH 7.8         EIEC fagoszómából való kiszabadulás

IpaH 9.8         EIEC immunválasz gátlása

IpgB1             EIEC invázió

IpgD               EIEC invázió, túlélés

Map                EPEC, EHEC   csupaszítás, SGLT1 gátlás, filopodium képzés, mitokondrium

károsítás

NleA               EPEC, EHEC   protein forgalom gátlás, tight junction károsítás

OspB              EIEC              immunválasz gátlás

OspE               EIEC, EPEC|, EHEC epitel sejt leválás gátlása

OspF               EIEC              immunválasz gátlás

OspG              EIEC              immunválasz gátlás

Tir                   EPEC, EHECintimin receptor, csupaszítás, SGLT1 gátlás, N-WASP

toborzás és alapzat kialakítás

VirA               EIEC              invázió, disszemináció

Egyéb

Tok                 NMEC, UPEC, EHEC, EPEC  védelem a gazda védekező rendszerekkel

szemben

Dispersin         EAEC             védelem az AAF kollapszus ellen

O acetylation  NMEC                        O antigen változékonyság

VirG               EIEC              N-WASP toborzás és disszemináció

Rövidítés jegyzék:

AAF, aggregative adherence fimbriae; Afa–Dr, afimbrial and fimbrial adhesins; BFP, bundle-forming pilus; CFs, colonization factors; Cif, cycle-inhibiting factor; DAEC, diffusely adherent E. coli; EAEC, enteroaggegrative E. coli; EAST1, E. coli ST1; EHEC, enterohaemorrhagic E. coli; EIEC, enteroinvasive E. coli; EPEC, enteropathogenic E. coli; ETEC, enterotoxigenic E. coli; HCP, haemorrhagic coli pilus; HlyA, pore-forming haemolysin A; LT, heat-labile enterotoxin; Map, mitochondrial-associated protein; NHE3, Na+–H+ exchanger 3; NleA, non-LEE-encoded effector A (also known as EspI); NMEC, neonatal meningitis E. coli; N-WASP, neural Wiskott–Aldrich syndrome protein; OmpA, outer-membrane protein A; Pet, plasmid-encoded toxin; Sat, secreted autotransporter toxin; ShET1, Shigella enterotoxin 1; SPATE, serine protease autotransporters of the enterobacteriaceae; ST, heat-stable enterotoxin; Stx, Shiga toxin (also known as verocytotoxin); T3SS, type III secretion system; TccP, Tir cytoskeleton-coupling protein (EspFU); Tir, translocated intimin receptor; UPEC, uropathogenic E. coli.

A fontosabb virulencia faktorok génjeinek elhelyezkedése

Lokalizáció     Elnevezés  Inzerciós hely          Virulencia faktorok a területen

EPEC

PAI                 LEE                selC                 T3SS, Tir, Map, EspB, EspF, EspG, EspH

(kromoszóma)                                                EspZ

Plasmid           EAF (pMAR2)                       BFP

fág                  pp2                  ybhc_ybhb                  espj, cif , nleh

fág                  pp4                  tors_tort                      nled, nlec, nleb,nleg

fág                  PP6                 ompW                         NleF, NleH, NleA

PAI                 IE2                  serX                            NleE, LifA-like

PAI                 IE5                  ssrA                            EspG, EspC

PAI                 IE6                  pheV                           NleE, NleB, EspL,LifA-like

EHEC

PAI                 LEE                selC                 T3SS, Tir, Map, EspB, EspF, EspG, EspH

EspZ

Plasmid           pO157                                    EspP, toxinB, LifA/Efa, StcE, HlyA and EhxA

fág                  Sp3/CP-933K             ybhC_ybhB                 NleB, NleC, NleD, Cif

fág                  Sp5/CP-933W                        wrbA                           Stx2

fág                  Sp9/CP-933P               yciE                            NleA (EspI), NleF, NleG, EspM,NleH, EspO

fág                  Sp14/CP-933U           serU                            TccP, EspJ

fág                  Sp15/CP-933V           yehV                           Stx1

PAI                 SpLE3/O122              pheV                           NleE, NleB1 and EspL2

ETEC

PAI                 Tia                              selC                            Tia, TibA

Plasmid           pCoo (pCS1)                                                 CFA/I, LT, STIb

Plasmid           pJY11                                                            LT, STIa

Plasmid           pTRA1                                                           pCoo és pJY11 mobilizáció

EIEC/Shigella

Plasmid           pINV                                                 T3SS, IpaA, IpaB, IpaC, IpaD, IpaH,

IcsABP, IpgB1, IpgB2, IpgD, OspF, OspB, VirA, SepA

PAI                 SHI-1 (she)                 pheV               Pic, ShET1 and SigA

Antivirulencia locus   Deléció

(fekete lyuk                                        cadBA és nadAB

 

EAEC

Plasmid           pAA                                                   AAF, Pet and EAST1

PAI                 sh                    pheV                          Pic, ShET1

DAEC

Plasmid           különféle elnevezések                        AAF/Dr adhesinek (néhány kromoszomális)

UPEC

PAI                 PAI-CFT073-pheV                pheV    Hly, Pap, Sat, polisziálsav transzport

 (Kps) proteinek

PAI                 PAI-CFT073-pheU                pheU              Pap2

PAI                 PAI-CFT073-aspV                aspV                PicU, CdiA, TosA (exotoxin)

PAI                 PAI-CFT073-serX                 serX                IroNEDCB, MchBCDEF

NMEC

Fág                  CUS-3                        argW                           O antigen modifikáció

PAI                 RDI 4                         serX                            S fimbriae

PAI                 RDI 16                       pheV                          K1 tok

PAI                 RDI 21                       leuX                P fimbriae, F17-like fimbriae, CNF1, Hyl

PAI                 RDI 22                       yjiD_yjiE                    IbeA

Rövidítések:

argW, tRNA; aspV, tRNA; BFP, bundle-forming pilus; cadBA, lysine metabolismus és transport gének; CdiA, contact-dependent inhibitor A; CFA, colonization factor A; Cif, cycle-inhibiting factor; CNF1, cytotoxic nectrotizing factor 1; DAEC, diffusely adherent E. coli; EAEC, enteroaggregative E. coli; EAF, EPEC adherence factor; EAST1, E. coli ST1; EHEC, enterohaemorrhagic E. coli; EhxA, enterohaemolysin A; EIEC, enteroinvasive E. coli; EPEC, enteropathogenic E. coli; ETEC, enterotoxigenic E. coli; HlyA, pore-forming haemolysin A; IE, insertion element; Kps, polysialic acid transport protein; LEE, locus of enterocyte effacement; leuX, tRNA; LT, heat-labile enterotoxin; Map, mitochondrial-associated protein; nadAB, NAD biosynthesis genes; NleH, non-LEE-encoded effector H; NMEC, neonatal meningitis E. coli; ompW, outer-membrane protein W gene; PAI, pathogenicity island; Pet, plasmid-encoded toxin; pheV, tRNA; Sat, secreted autotransporter toxin; selC, tRNA; SepA, serine protease A; serX, tRNA; ShET1, Shigella enterotoxin 1; ssrA, tmRNA; STIb, heat-stable enterotoxin Ib; Stx, Shiga toxin (verocytotoxin); T3SS, type III secretion system; TccP, Tir cytoskeleton-coupling protein (EspFU); Tir, translocated intimin receptor; TosA, RTX family exoprotein A, adhéziót mediál ; UPEC, uropathogenic E. coli; yehV, transcriptional regulator MlrA gene.

Az E. coli törzsek fontosabb virulencia faktorok ismertetése

(Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol, 8, 26-38, 2010, E. colivirulencia faktorok genetikai jellemzői, a baktériumok virulencia faktorai az NCBI, Genecards, Uniprot, KEGG, VFDB:Virulence factorsof bacterialpathogens, www.mgc.ac.cn/VFs/main.htm és WikiGenes adatbázisok alapján készültek)

A baktériumok betegség okozó képessége a virulencia faktorok jelenlététől függ. Funkcionális szempontból a virulencia faktorok a következőképpen osztályozhatók.

1.Adhezinek. A baktériumok felszinén elhelyezkedő struktúrák amelyek közvetítik a gazdasejtekhez való adherenciát.

2.Invazinok. A baktériumok felszínén lévő struktúrák, amelyek különböző mechanizmusokkal elindítják a baktériumok bejutását a gazdasejtbe.

3.Olyan virulencia faktorok, amelyek elősegítik a baktériumok intracellularis túlélését a gazdasejtben.

4.Antifagocita faktorok. Olyan, gyakran a baktérium sejtek felszínén elhelyezkedő struktúrák, amelyek a fagocitozist gátolják. Ilyenek a baktérium tokok, de ilyenek a gazdasejtbe injektált fagocitozist gátló viruencia faktorok is.

5.A gazdasejt apoptozisát befolyásoló faktorok. Egy részük gátolja, más részük elindítja az apoptozist.

6.Toxinok, amelyeket a baktériumok szekréciós rendszereikkel bejuttatnak a gazdasejtbe. A toxinok gazdasejtbe történő felvétele különféle mechanizmusokkal történik. A molekulák a sejtekre toxicus hatásúak

Adhéziós struktúrák, adherencia tényezők adhéziós mechanizmusok

DAEC, UPEC, EAEC adhéziós mechanizmusok

(Novicki B, Moulds J, Hull R, Hull S.A hemagglutinin of uropathogenic Escherichia coli recognizes the Dr blood group antigen. Immun Infect, 1988, 56, 1057-1060. Farfan MJ, Inman KG, Nataro JP. The major pilin subunit of the AAF/II fimbriae from enteroaggregative Escherichia coli mediates binding to extracellular matrix proteins. Infect Immun 2008, 76, 4378–4384, Servin AL. Pathogenesis of Afa/Dr diffusely adhering Escherichia coli Clin  Microbiol Rev 2005, 18, 264–292, Ashkar AA, Mossman KL, Coombes BK, Gyles CL, Mackenzie R. FimH adhesin of type 1 fimbriae is a potent inducer of innate antimicrobial responses which requires TLR4 and type 1 interferon signalling. PLOS Pathogens 2008, 4, 15, www.plospathogens.org alapján).

A bakteriális sejtfelszíni struktúrák képesek az epithel sejtekhez (intestinális és nem intestinális) kötődni. Ilyen bakteriális komponensek lehetnek a fimbriák, vagy pilusok, a sejtfal specifikus nyúlványai. Egy fimbria átlagosan 7 nm átmérőjű, és akár 1 mikrométer hosszúságú is lehet. A felépítő fehérje alegységek száma mintegy 1000. A fimbriákat felépítő specifikus proteinek, adhezinek kapcsolódhatnak az eukaryota sejtfelszin bizonyos komponenseihez, gyakran szénhidrát struktúrákhoz. A fimbriák adhezinjei kötődnek a vörösvértestek felszínén lévő vércsoport antigének szénhidrát összetevőihez is, és hemagglutinációt okozó képességük miatt hemagglutinineknek is nevezik ezeket. Régebben különféle vércsoport antigéneket hordozó vörösvértesteket alkalmaztak hemagglutinációs tesztekben a bakteriális adhezinek/hemagglutininek azonosítására.

A P-fimbriák a P vércsoport  antigéneka-D-Gal(1-4)P-D-Gal (Gal galactose) gyökeihez, az S fimbriák a glycophorin A O-kötött sialyloligosaccharid csoportjához (alpha-sialyl-(2-3)-13-D galactose- tartalmú receptor molekulák) kapcsolódnak.

Néhány E. coli törzs M vércsoport antigén specifikus hemagglutináló aktivitást mutat. Más törzsek heterogén vércsoport antigénekkel kapcsolódnak. Ezeket korábban X hemagglutinineknek nevezték. Ezek közé tartozott az E. coli O75 törzs hemagglutinije is (O75X), amelyről kiderült, hogy a Dr vércsoport antigénekhez kapcsolódik.

A fimbriák hemagglutináló aktivitásuk alapján három csoportba oszthatók.

Az első csoportba az emberi vörösvértestek mannose rezisztens hemagglutinációját előidéző fimbriák tartoznak, a P, az S és az M fimbriák. A második csoportba a tengerimalac vörösvérsejteket mannose szenzitív módon agglutináló fimbriák, így az I típusú fimbriák sorolhatók. A harmadik csoportba a hemagglutinációt nem okozó fimbriák, pl. az F1C fimbriák kategorizálhatók.

Az adhezinek lehetnek nem fimbriákban elhelyrezkedő, afimbriális struktúrák is, amilyenek a következőkben részletezett Afa/DR adhezinek is.

Afa-afimbriális adhezinek. Az Afa gén cluster afimbriális adhezineket kódol, amelyek az uropathogen és diarrhoae asszociált E. coli törzsekben expresszálódnak. Az Afa adhezinek az Afa/DR adhezin család tagjai. A gén cluster egy 6,7 kb DNS darab, adhezineket és invazinokat kódol. A gén cluster AfaA transzkripcionális regulator, AfaB periplazmikus chaperon fehérje, AfaC horgony fehérje, AfaD invazin, AfaG vagy draP és AfaE1-8 vagy draE adhezin elemekből épül fel.

Dr adhezinek az uropathogen coli törzsekben található adhezinek. Különböző jelöléseik ismertek, mint O75X, Dr haemagglutinin, Dr adhezin. A Dr adhezinek képesek a Dr vércsoport antigént hordozó emberi vörösvérsejtek haemagglutinációját előidézni, a Dr negatív vörösvérsejtekét azonban nem.

A vörösvértesteken két vércsort antigén fehérje complement reguláló protein. Ilyen a complement receptor 1 (CR1, CD35: a Knops antigének, C3b/C4b receptor, a complement aktivációs receptor család tagja /RCA, receptor of complement activation), 1q32,145 638bp, 2039AA, 223663 Da, 11 fehérje kapcsolat. 15801 SNP) és a decay accelerating factor (DAF, CD55: Cromer antigének,www.genecards.org).

A Dra vércsoport antigén a Cromer-vércsoport komplex része (az elnevezés onnan ered, hogy Mrs. Cromer szérumában találták meg az egyik antigén ellen irányuló antitestet 1965-ben). A vércsoport rendszer génjei a DAF génterületén vannak. Maguk az antigének a DAF fehérje extracelluláris részén helyezkednek el (8 gyakori, 3 ritka előfordulású antigén változat). A DAF complement reguláló protein, amely az 1. kromoszóma 1q32 régiójában a complement aktivációt szabályozó gén cluster területen helyezkedik el. A régió 4 membránhoz kötött fehérjét kódol. Ezek a complement receptor 1 (CD35, CR1, CD: cluster of differentiation), CR2 (CD21, complement C3d receptor, Ebstein-Barr vírus receptor, 1q32, 35 666 bp, 1033 AA, 112 916Da, 4 fehérje izoform, 12 fehérje kapcsolat, 494 SNP), membrán cofactor protein (CD46, MCP membrane cofactor protein, complement regulatory protein, a C3b és C4b szérum faktor 1 által történő inaktiváció kofaktora, amely megvédi a sejteket a complement károsító hatásától, receptorként szolgál a Neisseria IV-s típusú pílusai, a Humán Herpes Vírus-6 és a Kanyaró vírus Edmonston törzse számára. Részt vesz továbbá a spermiumok és a petesejtek fúziójában a fertilizáció folyamata során. A gén locus mutációja társul hemolítikus urémiás szindroma előfordulásával. A protein kostimulációs T sejt faktor, a T-reg1 sejtek differenciálódása során. A Treg1 sejtek gátolják az immunválaszt IL10 szekréciójuk révén. E tulajdonságuk hozzájárul az autoimmun folyamatok kialakulásának megelőzéséhez. A virális és bakteriális patogének ezt a tulajdonságot használják ki az immunszupresszió indukciójára, a CD 46-hoz történő kötődés révén. 1q32, 43 479bp, 392AA, 43 747 Da, 16 fehérje izoform, 25 fehérje kapcsolat, 561 SNP) és a DAF (CD55) (www.genecards.org). A DAF 55-70 kD protein (a glikoziláció szintje különböző), 381 aminosavból áll, 4 rövid, 60 aminosav méretű konszenzus ismétlődést (SCR short consensus repeat) tartalmaz. Nagy mennyiségű membrán asszociált DAF található a szájüreg és a gastrointestinalis mucosa, a vese tubulusok, az ureter, a húgyhólyag, a cervix, és a méh nyálkahártya epithel sejteinek felszínén. Fiziológiás körülmények között a DAF kapcsolatba lép a membrán kötött C3b és C4b-vel és megakadályozza a C2 és a B faktor kapcsolódását, így gátolva a complement kaszkád amplifikációját. A membrán kötött DAF a membránhoz glikozil foszfatidil inozitol kapcsolattal rögzül.

A baktérium gén cluster 6,6 kb hosszú, öt proteint expresszál, a DraA, DraB, DraC, DraD, DraE (Dr vércsoport antigénekről elnevezve) géneket. Négy gén, az A, C, D, E expressziója szükséges a mannóz rezisztens haemagglutináció kialakulásához. A Dr-II adhezin változat a pyelonephritogén EC7372 törzs egyik adhezinje és 17-20%-os azonosságot mutat az Afa/DR család egyéb tagjaival. 96%-ban azonos az NFA-I (non fimbrialis adhesin I) UTI (urinary tract infection) asszociált adhezinnel.

A Dr adhezineknek többféle specifikus receptora lehet, így a basal membrán IV-es típusú kollagén 7S domainje is. A IV-es típusú kollagénhez való kötődő képesség fontos a törzsek uropathogenitása szempontjából (Collagen type IV, COLIVA6, collagen alpha 6 type IV, a basalis membránok fő strukturális komponense, a glomeruláris basal membrán szerezeti proteinje, hálózatot képez a lamininnel, proteoglikánokkal és az entactin/ nidogen fehérjével. A IV típusú kollagénnek 6 izoformja ismert, alpha 1 (IV)-alpha 6 (IV), valamennyi tripla helix struktúrát képez két másik lánccal. Xq22, 295 948bp, 1691 AA, 163 807 Da, két fehérje izoform, 38 fehérje interkació, 1837 SNP, www.genecards.org).

F1845 adhezin egy fimbriális adhezin, a diarrhogen E. coli izolátumok diffúz sejt adherenciájában játszik szerepet. A daaA, daaB, daaC, daaD, daaE gének kódolják az adherenciában részt vevő öt polipeptidet. A gén egy 14, 3 kD szakaszon helyezkedik el és egyaránt lehet kromoszómális és plazmidon elhelyezkedő is, a különböző coli törzsek esetében.

A korábban leírtaknak megfelelően az Afa/ Dr és a fimbriális adhezinek specifikus kőtőhelyei közé tartozik a DAF komplement reguláló fehérje. A komplement reguláló proteinek (CRP complement regulating proteins) a CD46 és a DAF (CD55) több mikroorganizmus, baktérium számára szolgálnak felszíni receptorként. Valamennyi uropathogén és diarrhoeae asszociált E. coli törzs által expresszál fimbriális F1845, afimbriális AfaE1 és AfaE3, valamint a Dr és a Dr-II adhezineket és képesek kötődni a DAF fehérjéhez. Az AfaE7 és AfaE8 adhezinek nem kötődnek a DAF-hoz. A 165 pozíciójú szerin leucinnal történő szubsztitúciója, a Dra-Drb allél polimorfizmus, felfüggeszti a DAF-hoz való kötődést.

A CEA-CAM sejtfelszíni molekulák további receptorként szolgálnak az Afa/Dr adhezinek számára. Az Afa/Dr-I, F1845 és AfaE3 adhezinek kötődnek a CEA-CAM1, CEA és CEA-CAM6 sejtfelszíni struktúrákhoz. A CEA-CAM1 kötődik tovább a H. influenzae (OMP5, outer membrane protein), a M. catarrhalis és bizonyos Salmonella spp-k, valamint a N. gonorrhoeae proteinjeihez is. A CEA-CAM molekulák az adhezios molekulák immunglobulin szupercsaládjába tartoznak. A család gén clustere a 19q13.2 területen helyezkedik el. A család valamennyi tagjának N terminális részén IgG variábilis régió-szerű domain található, majd ezt követően 0-6 konstans IgG- szerű domain van jelen. Jelenleg a család hét tagból áll. A CEA-CAM receptorok különféle epithelialis, endothelialis és haemopoetikus sejteken expresszálódnak. A CEA-CAM receptorok glikozilációjának mértéke sejttípustól és a differenciálódás mértékétől függően változik. A CEA-CAM1, CEA, CEA-CAM 6, 7 a colon epithel sejtek apicalis glikocalix területén lokalizált, és szerepet játszanak a colon veleszületett immunfunkciójában. A membránba inzertálódott CEA-CAM1 három konstans immunglobulin szerű domaint tartalmaz. Alternatív hasadás révén azonban 8 membrán izoformja létezik, különböző számú extracellularis domainekkel, valamint vagy hosszú, vagy csonkolt citoplazmikus domain változatokkal.

A CEA-CAM-ok sejt-sejt adheziós molekulaként homofil sejtkapcsolatokat közvetítenek és részt vesznek a sejt proliferáció kontakt gátlásában konfluens sejthalmazban. Expressziójuk gátolt colon, máj és prostata tumorokban. A CEA-CAM 1 molekulák funkcionális ITIM (immunoreceptor tyrosine-based inhibition motif) régióval rendelkeznek és a humán granulocytákban és epithel sejtekben képesek NFkB (nuclear factor kappa B, transzkripciós faktor család) aktiváció révén előidézni további CEA-CAM1 expressziót, elősegítve ezzel a bakteriális adherencia további növekedését. Az NFkB aktiváció jelentős tényezője a CEA-CAM1-en keresztül történő hatékony bakteriális kolonizációnak. A baktérium a T lymhocytákban a CEA-CAM1 ITIM  motívumok aktiválása révén képes gátolni az adaptív immunválasz kialakulását. A CEA expresszálódik az intestinalis M sejteken, az enterocytákon és a colon epithel sejteken, integrális komponense az apicalis glycocalixnak. A CEA is homotipikus sejt-sejt adheziót elősegítő molekula. Nagy menniyégben termelődik minden humán colon carcinomában, valamint gyakorta a szervezet egyéb helyein kialakuló carcinomákban. A CEA hasonlóan más GPI (glycosylphosphatidylinisotol) horgonnyal a membránhoz rögzült proteinhez képes jelátviteli folyamatokat elindítani. Mikrobiális patogének kötődése a receptorhoz kis molekula tömegű GTP-ase enzimek, a rac1 (Ras-related C3 botulinum toxin substrate 1) és a cdc42 (cell division control protein 42 homolog) aktivációját váltja ki és gátolja az SHP-1 (Src homology 2 domain-containing protein tyrosine-phosphatase 1) tirozin foszfatáz enzim aktivitását (Protein tyrosine phophatase non –receptor type 6, SHP-1, a protein tirozin foszfatáz család tagja, számos jelátvivő folyamat szabályozói, résztvesznek a sejtnövekedésben, differenciálódásban, mitotikus cikulusban és onkogén transzformációban. N terminális részükön 2 tandem Src homolog (SH2) domaint tartalmaznak,amely közvetíti a foszfotirozin csoportokkal való kapcsolódást a szubsztrát fehérjéken. Az enzim eltávolítja a foszfor csoportokat a tirozin reziduumokról. 12p13, 14 849 bp, 595 AA, 67 581Da, 3 fehérje izoform, 203 fehérje kapcsolat, 237 SNP, www.genecards.org). A CEA-CAM6 két konstans IgG szerű domaint tartalmaz és a membránhoz szintén GPI horgonnyal rögzül. Hasonlóan a CEA-hoz, ez is a colonociták apicalis részén helyezkedik el és intracellularis szignál kiváltására képes. Megnövekszik a cSrc (src sarcoma röviditése, non-receptor tirozin kináz családtag, protooncogén, orvosi-élettani Nobel díj Bishop JM és Varmus HE, 1989, a génje hasonlít a Rous sarcoma vírus v-src génjéhez, SRC1 / SCH Smidt-Ruppin A-2 viral oncogene homolog, avian. Non- receptor protein tirozin kináz, részt vesz a sejtprolieráció, mifráció ás transzformáció szabályozásában. 8 SRC kináz ismert/ Src, fyn, yes, lck, lyn, hck, fgr, blk, amelyek kapcsolódnak növekedési faktor és citokin receptorok, G protein kapcsolat receptorok és integrinek intracelluláris domainjeihez. SRC, 20q12 - q13, 61 366 bp, 536 AA, 59835 Da, 2 fehérje izoform, 532 fehérje kapcoslat, 918 SNP, www.genecards.org) és a p125/FAK (focal adhesion kinase) enzim caveolin 1 dependens tirozin foszforilációja. A CEA-CAM6-hoz való kötődés elősegítheti továbbá a baktériumok adhézióját az extracellularis mátrixhoz alfaVbéta3 integrin közvetítéssel. A CEA és a CEA-CAM6 hatására az Afa/Dr DAEC törzsekkel történő kapcsolódás PKB (protein kinase B) - AKT (AK egértörzsből izolált transzformáló onkogen, v-akt, thymus lymphomát okoz) aktivációhoz vezet a sejtekben. Ennek hatására fokozódik a colon epithel sejtek túlélése. A CEA és a CEA-CAM6 kapcsolódás elősegítheti az Afa/Dr DAEC törzsek internalizációját az intracellularis aktin citoszkeleton átrendeződése nélkül. A folyamat lipid raftok közvetítése révén jön létre.

Az uropathogen és az enterális pathogén coli törzsek is képesek behatolni, majd replikálódni az epithel sejtekben. Az Afa/Dr DAEC törzsek zipzárszerű mechanizmussal hatolnak be a sejtbe. Ez receptor mediált mechanizmus, amely elősegíti mikrofilamentumok citoszkeleton függő kialakulását és pseudopodiumok képződését. A folyamathoz receptor-ligand kapcsolat, majd receptor clustering, fokális adheziós kináz (FAK) aktiválódás, citoszkeletális kis GPT molekulákat kötő fehérjék által előidézett átrendeződés szükséges. A Dr pozitív E. coli törzsek, az uropathogén FimH pozitiv törzsek és az EIEC coli törzsek zipzár mechanizmusú internalizációja több tekintetben különbözik.

A FimH (1-es típusú pílusok adhesinje, mannóz tartalmú receptorokhoz kapcsolódik) pozitív coli törzsek lipid raft dependens internalizációs mechanizmussal lépnek a sejtbe makropinocytozisra jellemző módon, masszív sejtmembrán átrendeződés történik. Jelentős a proteinek tirozin foszforilációja, két rho GTP-ase családtag, a cdc42 és a rac1 aktivációja is létrejön. Az internalizáció F aktin függő folyamat.

Az LF82 1-es típusú pílus önmagában nem elég az EIEC coli törzsek internalizációjához, de a pílus mediálta adherencia elősegíti a membrán elongációját, ami makropinocytozis egyik kezdeti lépése.

Az Afa/Dr DAEC család adhezinjei közül több invazin tulajdonságú fehérje. Ezek közé tartozik DraD invazin.

Az Afa/Dr DAEC törzsek is képesek zipzárszerű mechanizmussal belépni az epithel sejtekbe. Ebben mind Afa, mind Dr fehérjék szerepet játszanak. Az AfaD, a DraE, és D rendelkeznek invazív tulajdonságokkal. Ezek kötődnek a DAF-hoz és asszociálódnak az alfaVbéta1 integrinnel és elindítják az internalizációt. A DAEC törzsek sejtbe történő belépése azonban nem apicalisan, hanem bazolateralisan történik.

Az EAEC AggB proteinje és az AfaD egymással rokon invazin molekulák. Az Afa/ Dr adhezinek a DAF és a CEA molekulákhoz kötődve képesek a lipid raftok funkcióját megváltoztatni. Az internalizáció területén megnövekszik a receptor–ligand denzitás. Az adheráló baktériumok lipid raft asszociált molekulákat toboroznak, így gangliozid GM1-et, caveolin/Vip21-et (vesicular integral protein, caveolin 3, a caveolák plazmamembránjának komponense. A caveoláris fehérjék kapcsolatot kialakító proteinek, protein oligomerizációt alakítanak ki a membránban. Direkt kapocsolatba lépnek a G proteinek alpha alegységével és szabályozzák aktivitásukat. Irányítják továbbá a feszültség függő kálium csatornákat, a sarcolemma és a cardiomyocyták membránjának regenerációs folyamatát. Homoolgomer formációt alkotnak. 3p25, 108007bp, 151 AA, 17259 Da, 44 fehérje kapcsolat, 319 SNP, www.genecards.org), PI3 kináz, foszfolipáz C gamma (PLC-1, az enzim kálcium függően katalizálja a foszfatidil inozitol 4,5 biszfoszfátból az inozitol 1,4,5,-triszfoszfát és diacilglicerol képződését. Szerepet játszik az aktin reorganizációban, a sejtmigrációban, a két generált vegyület második messenger molekulaként működik növekedési faktorok és az immunrendszer jelátvivő útjában. A foszfolipázok béta, gamma, delta, epszilon, zeta, és eta altípusai ismertek. PLCG-1, 20q12-q13.1, 38762 bp, 1290 AA, 148 532 DA, 2 fehérje izoform, 382 fehérje kapcsolat, 583 SNP, www.genecards.org) cdc42 (cell division cycle) és MAPK (mitogen activated protein kinase) stimulációt váltanak ki. Megnyúlt pseudopodiumok, F aktin és villin átrendeződés (VIL1, villin 1, kálcium regulált aktin kötő fehérje család tagja, a kefeszegély citoszkeleton része, az aktin filamentumok kötegelését és fedését végzi. Az S. flexneri / EIEC /fertőzések kapcsán az aktin metsző aktivitás növeli a baktériumok motilitását és szerepel a fertőzés disszeminációjában. 2q35, 34 204 bp, 827 AA, 92 695Da, 12 fehérje kapcsolat, 426 SNP, www.genecards.org) kefeszegély lézió következik be és végeredményben dinamikus mikrotubulus dependens internalizáció jön létre. A baktériumokat tartalmazó vakuolumokban a kórokozók jelentős mértékben nem szaporodnak, azonban akvirálnak olyan cellularis molekulákat, amelyek elősegítik a túlélésüket. A DAEC infekciók során a paracellularis permeábilitás is fokozódik, mert egyes tight junction proteinek, a Zo1 (zona occludens, TJP1, tight junction protein 1, az intercellularis tight junction fehérjéje a sejtek közötti jelátvitelben szereplő fehérje, homo és heterodimert képez a Zo2 és Zo3 fehérjékkel. Kapcsolódik az occludin, claudin, cingulin, és más fehérjékkel. 15p13, 256 927 bp, 1748 AA, 195 429 Da, 2 fehérje izoform, 123 kapcsolódó protein, 1463 SNP) és occludin (OCLN, integrális membránfehérje, a citokin indukált tight junction paracellularis permeábilitásának szabályozását irányító fehérje. 5q13.1, 65813 bp, 522 AA, 59 144 Da, 21 fehérje kapcsolat, 184 SNP) átrendeződnek (www.genecards.org).

Afa/Dr DAEC infekciók során bekövetkezik a kefeszegély károsodása is. A kefeszegéllyel társult intestinalis fehérjék, mint szukráz, izomaltáz, dipeptidil peptidáz IV, nátrium- glukóz cotransporter 1, fruktóz transporterek mennyisége és aktivitása jelentősen csökken.

Az Afa/Dr DAEC törzsek proinflammatorikus hatását megfigyelték in vitro intestinalis sejtkultúrákon. Ezek az adhezinek meggyorsítják a neutrofil granulocyták apoptozisát a procaspase 3 aktiválása révén. Az apoptotikus folyamat nem DAF, CEA-CAM1, vagy CEA kötődéssel volt kapcsolatos, hanem az adhezinek agglutinációs képességével. A DAEC törzsek PMNL (polymorphonuclear leukocytes) transzmigrációt indukáltak, fokozódott az epithel sejtek TNF alfa és IL-1béta szintézise. A citokinek növelték a DAF expresszióját, aminek következtében fokozódott a DAEC törzsek adherenciája az intestinális sejtekhez. Ez tovább növelte a gyulladásos folyamatot. A gyulladáskeltő és azt fenntartó circulus vitiosus alapján felvetődött a mechanizmus patogenetikai szerepe ulceratív colitisben. Fokozódik továbbá egy másik, gyulladásos folyamattal társult molekula,  a MICA (MHC class I chain-like gene A, MHC / HLA class I- rokon gén A, stressz indukálta antigén, a bél epithel gamma/delta T sejtjei ismerik fel. E. coli, M. tuberculosis, CMV, Adenovírus 5 indukálja expresszióját. 6q21.33, 66026 bp, 383 AA, 42915 Da, 2 fehérje kapcsolat, 464 SNP, www.genecards.org) expressziója is, amely egy Maior Histocompatibilitási Complex  (MHC) I. osztályú molekula homológ. Interakcióba lép a HLA B molekulákkal és kapcsolódik a gamma/delta T sejtek TCR (T cell receptor)-val a bélben. A fehérje expressziója emelkedik Crohn betegek colon biopsziás mintájában, és a protein részt vehet az arthropathia patomechanizmusában is.

A DAEC adhezió indukálta PMNL transzmigráció és apoptozis elősegíti a CD97 (DAF kötő, EGF családhoz tartozó 7 TM molekula, EGF: epidermal growth factor, 7 TM: 7 transzmembrán domain, a fehérje önkatalizált proteolizis során nagy extracellularis alegységre és 7 TM transzmembrán alegységre hasad és a sejtfelszínen, mint receptor ligand komplex helyezkedik el. Részt vesz a sejtadhaesioban, a leukocyták toborzásában, aktivációjában, migrációjában a CD55-hez való kapcsolódásban leukocyta aktiváció során. 19p13, 27323 bp, 835 AA, 91869 Da, 3 fehérje izoform, 3 protein kapcsolat, 409 SNP, www.genecards.org) közvetítette jelátvitel aktivációját. Fokozódik a CD97 expresszió a limfociták, makrofágok és leukociták felszínén. Ez a molekula a DAF-hoz kötődik és feltehetőleg szerepet játszik az inflammatorikus sejtek enterocytákkal való kapcsolódásában és a gyulladásos folyamat fokozódásában a DAEC infekciókban. Ezek a molekuláris tényezők közreműködhetnek a gyulladásos bélbetegségek patomechanizmusában.

A monociták, makrofágok, dendritikus sejtek felszínén jelenlévő DAF közreműködik az LPS megkötésében a multimer receptor komplexben, a CD14-vel (az MD-2 és TLR4 kooperációjával megköti az LPS-t és aktiválja a TLR4 jelátvivő utakat, amelynek következtében a dendritikus sejtek, monociták, makrofágok citokin termelése adhezios molekulák expressziója, kemokinek termelődése és gyulladásos válaszreakció indul el. GPI horgonnyal rögzül a membránhoz. 5q22-q32/5q31.1,1974 bp, 375 AA, 40076 Da, 19 fehérje kapcsolat, 63 SNP), Toll- like receptor 4-vel (CD 284, Toll like receptor 4, a TLR család tagja, patogén felsimerésben, veleszületett immunapparátus aktiválásában részt vevő LPS receptor. 9q33.1, 13 309 bp, 839 AA, 95680 Da, 3 fehérje izoform, 62 fehérje kapcsolat, 4 alternatív splice mintázat, 4 exon, 289 SNP), LPS kötő fehérjével (LPS-binding protein LPB, az akut fázis immunológiai válasz során szintézise nő, kötődik a baktériumok külső sejtfalának LPS-e lpid A részéhez, a bakteriális permeábilitást fokozó fehérjével /BPI együtt és kapcsolatba lépnek a sejtfelszíni CD14-vel. Közös fehérje családot alkotnak a BPI-vel, a cholesterin észter transzfer proteinnel (CEPT) és foszfolipid transzfer proteinnel (PLTP) 20q11.23, 30907 bp, 481 AA, 53384 Da, 11 fehérje kapcsolat, 689 SNP, www.genecards.org) stb. együtt (Fiziológiai és orvosi Nobel díj 2011, Bruce Beutler). A baktériumok, ill. az LPS kötődése a receptor komplexhez adaptor molekulákon, szerin/ treonin kinázokon keresztül számos jelút és transzkripciós faktor pl. NFkB aktiválódásához vezet. Ezek a veleszületett immunapparátus inflammatorikus mediátorait, így a TNF alfa, IL-1, IL-12, stb. szekrécióját indítják el, amelyek szintén szerepet játszanak az inflammatorikus bélbetegséghez vezető patogenetikai folyamatban. A multimer LPS kötő receptor komplex további komoponensei hsp70, hsp90 (hsp heat shock protein, chaperon fehérjék), kemokin (CXC) receptor 4 (CXCR4, CD185, 7 TM receptor családba tartozik, stromal cell-derived factor-1 receptora), myeloid differenciálódási faktor (MD myeloid differentiation) 2. Ezek a molekulák a baktérium- LPS- CD14- TLR 4 interakció helyére toborzódnak a lipid raftokban. Önmagában az LPS szignalizáció jelentősen kisebb aktivációt eredményez a TLR4-en keresztül, azonban a bakteriális infekció során egyéb TLR receptorok is aktiválódnak (TLR 1-11, a Toll- like receptorok, pathogen asszociált mintázatokat és endogén veszélyszignál kapcsán generált ezekhez hasonló mintázatokat felismerő membrán receptor struktúrák, a veleszületett immunválasz felsimerő egységei, elindítják az inflammatorikus választ citokinek, kemokinek, adhezios molekulák termelődését, és következményesen hozzájárulnak a specifikus immunválasz elindulásához), amelyek jóval nagyobb stresssz aktivált protein kináz, c-jun N terminális kináz és MAPK aktivációt eredményeznek közösen az Afa/Dr adhezin szignalizációval és a CEA-CAM 1, 6 receptorok bevonódásával. Mind a CEA, mind a CEA-CAM 6 expressziója jelentősen megnő inflammatorikus colon betegségekben és a CEA-CAM 1 expressziója is stimulálódik proinflammatorikus citokinek, pl. TNF alfa hatására. A pathogén coli törzsek mind adheziós molekuláik, mind LPS-ük révén sokkal nagyobb mértékben növelik a CEA-CAM 1, CEA és CEA-CAM-6 expresszióját (in vitro colon T84 sejteken). Ezek alapján vetődött fel gyulladásos bélbetegségekben, colitis ulcerosában és Crohn betegségben mikrobiális pathogének, közöttük egyes E. coli törzsek patogén szerepe, főként a mannóz rezisztens adhéziót mutató törzseké. Az NCBI adatbázisában több gyulladásos bélbetegséggel társult coli törzs genomjának szekvenciája szerepel.

EAEC adherencia faktorok

AAF: aggregativ adherence fimbriae, a Dr adhezios családhoz tartoznak. A vonatkozó gének: aafA, B, C, D, agg3A, B, C, D, aggA, B, C, D, R. Legalább négy allél variáns létezik (AAF/I, II, III és Hda). Mindegyik variáns csak a törzsek töredékében van jelen. Valamennyi EAEC törzs rendelkezik 60-65 MDa plazmiddal, amely az aaf/1 és 2, valamint alkalmanként enterotoxin EAST1-et és Pet-t kódol. Struktúrálisan az AAF flexibilis, 2-3 nm átmérőjű fimbria, amely kötegeket is képes alkotni. Nincs homológia e között és a IV típusú EPEC Bfp (bundle forming pilus) fimbriális fehérje között. Az aaf1 gének két külön clusterben helyezkednek el a 60 Mda plazmidon, köztük található egy 9 kb DNS terület. Az 1-es génrégió kódolja a fimbriális struktúrát, a 2-es génrégió pedig a transzkripcionális aktivátort, az aggR-t. Az aaf2 gének szintén két különböző clusterben helyezkednek el. Az egyes régió az aafA, R és a chaperon aafD-t, a 2-es régió az aafC-t kódolja. A receptorok nem ismertek, az AAF/II kötődik a fibronectinhez.  Az AAF-ek fimbriális extenziója pozitív töltéssel rendelkezik. A negatív töltésű lipopolisacchariddal (LPS) való kötődést a szekretált dispersin molekulák sejtfelszini kapcsolódása gátolja meg. Ez a mechanizmus segíti elő az EAEC törzsek diszperzióját a mucosalis felszínen, gátolva az EAEC törzsek egymással történő kapcsolódását.

Dispersin, antiaggregation protein. A vonatkozó gének: AAP, AspU, AAT A, B, C, D, P. (AAP antiaggregation protein, aspU EAEC secreted protein U, AAT anti-aggregation protein transporter). A fehérjét kódoló gén az AAP, amely a közvetlenül mögötte (downstream) elhelyezkedő AggR (fimbriális gén regulator) transzkripcionális aktivátor kontrollja alatt áll. A dispersin ABC transzporter komplex működése révén kerül a baktérium sejt felszínére. A transzportert kódoló gén cluster tagjainak jelölése AAT P, A, B, C, D. A dispersin fehérje szignál szekvenciát tartalmaz és az extracellularis miliőbe szekretálódik, és nem kovalens kötés révén tapad a baktérium sejt felszínére. Elősegíti az EAEC törzsek dispersioját az intestinalis mucosa felszínen, lehetővé teszi új infektív fókuszok kialakulását és megkönnyíti a baktériumok hatékony colonizációját.

A dispersin a baktériumok felszínén az immunsejtek számára jól hozzáférhetően helyezkedik el, ezért a kórokozó elleni vakcina kialakításában is szerepel célpontként.

A közelmúltban EAEC törzsekben azonosítottak galaktóz specifikus fimbriális, 18 kD-os, más adhezinekkel aminosav szekvencia azonosságot nem mutató, mono-, di- és tetramer kapcsolódású adhezint (Grover V, Ghosh S, Chakraborti A, Majumdar S, Ganguly NK. Galactose-specific fimbrial adhesin of enteroaggregative Escherichia coli: a possible aggregative factor. Current Microbiol 2007, 54, 175–179).

ETEC adherencia

Adhezív fimbriák: vonatkozó gének cfaI, cofA, cooA, cs3, cs5, csbA, cseA, csnA, cssA, csvA, cswA. Ezeket colonizációs faktoroknak (CF colonization factor), colonizációs faktor antigéneknek (CFA colonization factor antigen), coli surface antigéneknek (CSA coli surface antigen) illetve putatív colonizácios faktoroknak (PCF putative colonization factor) nevezik. A kolonizációs faktorokat struktúrájuk alapján fimbriákra és fibrillumokra osztják. A fimbriális CF-k rigid filamentozus, rúdhoz hasonló struktúrák, a fibrilláris CF-k vékonyabbak, flexibilisek, kevesebb alegységük van. Funkcionális szempontból adhezinek, receptoraik glikolipidek, glikoproteinek oligoszaccharid komponensei.

Az ETEC törzsek gazdaspecifitását a kolonizációs faktorok közvetítik. A humán ETEC törzsekben 21 különböző kolonizációs faktort azonosítottak. Az emberi ETEC törzsek 75%-a expresszál vagy CFA/I, CFA/II, vagy CFA/IV-t. Az ETEC törzsek többféle plazmidot hordoznak. A CF kolonizációs faktorokat kódoló gének plazmidokon találhatók

UPEC adherencia

1-es típusú fimbriák: vonatkozó gének fimA, B, C. D, E, F, G, H, I (fim fimbrial proteins). Úgynevezett mannóz érzékeny (MSHA mannóz sensitiv hemmaglutination) fimbriák. A vörösvérsejtek hemagglutinációja mannóz jelenlétében meggátlódik. Az 1-es típusú fimbriákat kódoló gének nemcsak az UPEC törzsekben, hanem szinte valamennyi E coli törzsben jelen vannak. Ezek a fimbriák virulencia faktorként csak a húgyúti infekciók patogenezisében szerepelnek. Az 1-es típusú fimbriák expressziója fázisfüggően változékony, a szabályozás transzkripcionális szinten invertibilis elemek működése révén valósul meg. Az 1-es típusú fimbriák operonja a követőképpen épül fel: a fimB és E rekombinázok, ezt követi az invertibilis génszakasz. A fimA a pilusok proteinjét kódolja, a fimC chaperonként működik, az utóbbi kettő közötti génterület a fimI, amelynek funkciója nem ismert. A fimD ajtónálló funkciójú, a fimF, G a fimbriák csúcsán lévő proteineket kódolja, a fimA szintén, ehhez is kötött az adheziós funkció.

A fimA struktúrprotein génjének sigma70 promotere 314 bp-val előbb, az invertibilis elem területén helyezkedik el. A promoter mindkét oldalán 9 bázispár hosszú, fordított DNS ismétlődés helyezkedik el.

A leucin responsive fehérje (LRP), az integration host factor (IHF) és a histon-like protein H-NS (heat-stable nucleoid-structuring protein) kötődik az invertibilis elem körüli DNS szekvenciákhoz és magához az elemhez. A kötődés gátolja az invertibilis elemmel szomszédos rekombináz aktivitású fimB, és E működését.

Az 1-es típusú fimbriák alapvető szerepet töltenek be a húgyhólyag epithel sejtejeinek colonizációjában. A fimbriák hegyén elhelyezkedő fimH a receptorral kapcsolódó adhezin fehérje, ez kötődik a mannóz tartalmú glikoprotein receptorokhoz, az epithel sejtek felszínén lévő uroplakin molekulákhoz. A kapcsolódást követi az uroepithel sejtekbe történő invázió.                          

F1C fimbria: vonatkozó gének focA, C, D, F, G, H, I. Az F1C (foc fimbriae of Escherichia coli). Hemagglutinációt nem okozó adherencia faktor. A húgyúti rendszer gyulladását okozó  UPEC E. coli törzsek 14%-a, a faecalis coli izolátumok 7%-a expresszálja. Genetikailag homológ az S fimbriákkal, de a receptor specifitásuk különbözik. Az F1C fimbriális komplex fő alegysége a 16 kD-s FocA fehérje, a minor alegységek a FocF (17 kD), FocG (15 kD) és FocA (30 kD). Glikolipidek, a sialoGM1, 2, Gal NAC béta1-4 Gal béta (galaktóz, N-acetil glukózamin) szekvenciához kötődik nagy affinitással. Járulékos, alacsony affinitású kötőhelyei a Glc NAC béta 1-3 Gal béta, Gal béta 1-4 Glc a glikolipidek felszínén.

P fimbriák: a vonatkozó gének papA2, papB, papB2, papC, papC2, papD, papD2, papE, papE2, papF, papF2, papG, papG2, papH, papH2, papI, papI2, papJ, papJ2, papK, papK2.

A Pap (pyelonephritis-associated pilus) pilusok környezeti és nutricionális tényezők által regulált folyamat során expresszálódnak metiláció függő mechanizmussal. A pap operon működése típusos példája a pílusok felépülését irányító folyamatnak. A PapI, PapB, PapC regulátorok.  A Pap C a külső membránban pórust képez, a PapD alegység és a hozzá kapcsolódott fehérjék transzlokációját elősegítve a külső membránba. A PapD periplazmikus chaperon, IgG szerű domainje szükséges a pilus alegységek citoplazma membránból a külső membránba való transzportjához. A PapK és F adaptorok és iniciátorok, a PapE a fimbria hegyének alkotó proteinje, a PapG adhezin.

A papA a fő szerkezeti alegység, 6,8 nm vastag helikális pálcává épül fel. A külső membránban a papH révén horgonyzódik le. A papH a pálca terminátor proteinje. A pilus pálca distalis végén egy 2 nm-s lineáris csúcsi fibrillum található, mely PapE fehérjékből áll. Ezt a szerkezetet a PapA pálcához a PapK adaptor fehérje köti. A PapE a csúcsi fibrillumokhoz a PapG és a PapF adaptor proteineken keresztül kapcsolódik. A PapG tartalmazza a receptort kötő domaint. A PapG bináris komplexként kötődik a Gbo4 receptorhoz (globoseries of glycolipids). A kötődés az alfa-D-galactopyranozil-(1-4)-béta-D-galactopyranoside gyökön történik, amely számos glikolipidben megtalálható a felső húgyúti traktusban és az erythrocytákon. A három PapG adhezin variáns a PapG-G-I ,G-II és G-III, három különböző, de rokon szerkezetű gal-alfa (1,4) gal receptort ismer fel. A PapG kötődés a glikolipid receptorokhoz mind a baktériumokban, mind az uroepithel sejtekben specifikus változásokat indukál, ami elősegíti a baktérium virulenciáját. A baktérium sejtben aktiválódik a vas felvételi rendszer, a gazdasejtekben elindul a glikolipid receptorokról a ceramid intracellularis felszabadulása. Ez második jelátvivőként aktiválja a ceramiddal aktiválódó serin-treonin protein kinázok és foszfatázok közvetítésével az uroepithel sejtek citokin termelését, pl. TNF alfa.

S fimbriák: az sfa (S fimbrial adhesin) operon kódolja a rendszer 9 génjét. Az sfaA, B, C, D, E, F, G, H, S géneket. Az sfaC és B regulátorok, az sfaA fő alegység, az sfaG, H, S minor alegységek, az sfaD, E, F a transzportot és a szerkezeti összeépülést irányítják. Az adhezin funkció az sfaG-hez S-hez és H-hoz kötött.

Az sfaS alegység az S pílus csúcsán helyezkedik el és ez közvetíti a baktérium összekapcsolódását a sziálsav maradékot tartalmazó receptorokkal.

Az S fimbriák az uroplakin 3 membrán protein sziálsav maradékához kapcsolódnak.

NMEC adherencia

S fimbriák: vonatkozó gén sfaA. Az adherenciában szerepet játszó fimbriák egy fő alegységből (SfaA) és minor alegységekből (SfaG, S, H) épülnek fel. Az SfaS az S fimbriák csúcsi részén lokalizált. Az S fimbriákon két kötő domaint azonosítottak. A SfaS adhezin a BMEC (brain microvascular endothelial cell) / PNEC (pulmonary neuroendocrine cells) sialo- glikoproteinhez, és a BMEC szulfatált glikolipidhez kapcsolódik. Az S fimbriák kötődnek a fibronectinhez is. A fibronectin (FN1) solubilis, dimer plazmában jelenlévő glikoprotein, valamint dimer és multimer formában az extracellularis matrixban és a sejtek felszínén jelen lévő sejtadheziós fehérje. Szerepet játszik a védekező mechanizmusokban, a véralvadásban, sebgyógyulásban, metastasis keletkezésben és az embriogenezisben. Számos fehérjével illetve egyéb molekulával lép kapcsolatba, pl. kollagén, fibrin, aktin, DNS, heparin. Sejtfelszíni kötőhelyei egyes integrinek. 2q34, 75733 bp, 2386 AA, 262625 Da, 15 fehérje izoform, 178 protein kapcsolat, 1202 SNP (www.genecards.org).

EHEC adherencia

Ecp: E. coli common pilus, az Ecp 21 kD pilin alegységekből (EspA) épül fel, píluson lévő adherencia faktor, ami alapvető az E. coli O157 emberi törzsek virulenciájában. A faktor azonban megtalálható kommenzális E. coli törzsekben is, és ennek alapján úgy gondolják, hogy a patogén E. coli törzsek mimikriként használják. A kommenzális E. coli törzsekhez való hasonlóság ökológiai előnyt biztosíthat a gazda kolonizációjában és az immunrendszer egyes hatásainak elkerülésében. Kódoló gének ecpA, B, C, D, E, R

Efa1/Lifa: EHEC factor for adherence/ Lymphocyte inhibitory factor, adhezinként működik a non O157: H7 EHEC törzsekben és funkcionális szempontból gátolja a limfocita aktivációt.

Kódoló gén: efa1, 14672-24343 bp között helyezkedik el.

Intimin: 934 AA (amino acid), 94kD, a LEE locusban kódolt külső membrán fehérje, az N terminális horgony rész rögzíti a proteint az EHEC törzsek külső membránjában és a génszekvencia általában nem nagyon változó. A C terminális intimin rész nyúlik ki a baktérim felszínéről és kötődik a TIR receptorhoz. A C terminális rész szekvenciáját tekintve igen változékony, amely szerepet játszik a szöveti tropizmus kialakításában. A C terminális szekvencia variációk alapján legalább 9 intimin altípust írtak le, alfától kezdve jelölték őket. Az intimin C terminális része három tandem IgG szerű domaint, majd ezt követően egy C típusú lectin domaint tartalmaz, ezen helyezkedik el a TIR kötőhely. Az intimint kódoló gén az eae (enterocyte attachment and effaceing) vagy eaeA.  Az intimin járulékos receptora a béta 1 integrin és a nucleolin.

Tir: transzlokálódott intimin receptor, TTSS apparátus transzlokálódott proteinje, génje a tir, ami a Z5113 és a Z5111 génrészleltek között helyezkedik el az LEE patogenitási sziget TTSS clusterében. Az EHEC és EPEC törzsek Tir fehérjéjének funkciója különbözik. Gazdasejt membránjában kialakuló protein komplex az EPEC törzsekben a Tir tirozin foszforilációja után az NCK (non-catalytic region of thyrosin kinase adaptor protein 1,2) adaptor proteinnel kapcsolódik, amely azután az NWASP/ ARP2,3 proteineken keresztül vezet az aktin citoszkeleton modifikációjához. Az EHEC törzsekben az intimin Tir-hez és nucleolinhoz kapcsolódik a gazdasejt membránjában. A Tir itt nem foszforilálódik és nem NCK adaptor proteinen, hanem inzulin receptor tirozin kináz szubsztrát fehérjén, BAIAP2L1, IRSp53 és TCCP/EspFu (Tir cytosceleton coupling protein)-en kresztül kapcsolódik az NWASP/ ARP2,3 fehérje komplexhez és indítja el az aktin citoszkeleton átrendeződést.

Az EPEC és EHEC törzsek Tir domainjének szerkezete különböző, a két törzs esetében a homológia 44%-os.

EPEC adherencia

BFP: Bundle forming pili. A rendszer génjei a bfpA, B, C, D, E, F, G, H, I, J, K, L, P, Q.

IV-es típusú pilus rendszer, a baktérium-gazdasejt adherenciában játszik szerepet. A bfp géncluster az EAF (EPEC adherence factor) plazmidon helyezkedik el. Az EAF plazmid per locust tartalmaz (plasmid encoded regulator), amelynek produktuma szabályozza mind a BFP operont, mind az LEE patogenicitási sziget génjeit, az utóbbit a LER (LEE encoded regulator) szabályozásával.

A IV-s típusú, B osztályú fimbriák jelen vannak az ETEC, a Salmonella typhi és a Vibrio cholerae törzsekben is.

A BFP géncluster számos fehérjét kódol (A-Q), közöttük bundlint- BFPA, secretint-BFPB, NTP kötő fehérjéket-BFPD, F, pilin szerű proteineket-BFPI, J, K, prepilin peptidaset-BFPP, transglukozilázt-BFPH stb.

A pílusok szerepet játszanak az adherenciában és az autoaggregációs fenotípus kialakulásában. Receptoraik oligoszaccharidok, pl. N-acetil-glukózamin.

Intimin: az EPEC törzsek intimin proteinje 94 kD-os külső membrán fehérje, az LEE patogenicitási szigeten belül az eae génterületen kódolódik. Az intimin fehérje szekvenciája kis különbségeket mutat az EPEC törzseken belül, amelynek alapján 9 intimin altípust különböztetnek meg, és ezeket görög betűkkel jelölik. Az EPEC törzsek gazdasejtekhez történő kapcsolódása esetén az intimin-Tir kötődést a Tir 474. pozíciójú tirozinjának foszforilációja követi. A receptorhoz ezután kötődik az NCK adaptor és az NWASP/ ARP2,3 fehérje komplex, ami elindítja az aktin nucleációt. A Tir transmembrán 1-es domainjének N terminális végéhez alfa aktinin és tallin is kapcsolódik. A citoszkeletális proteinek és az aktin polimerizációja az A/E léziókra- jellemző eltérés a szoros bakteriális kontaktus létrejöttekor. Alternatív intimin kötőhelyek az enterociták felszínén a béta1 integrin és a nucleolin.

Lymphostatin/LifA/Efa1(lymphocyte inhibitory factor A/EHEC factor for adherence-1): toxin és adherencia faktor, nagyméretű, 385 kD molekula tömegű fehérje, ami az LEE patogén szigeten kívűl kódolódik. Az EPEC törzseken kívül az EHEC törzsekben is jelen van. A fehérje részt vesz a baktériumok adherenciájában, és gátolja számos limfokin pl. az IL-2 (interleukin), IL-4 (pleiotrop, aktivált T sejtek által termelt citokin, a Th2 válasz szabályozója, részt vesz a B sejt aktivációban, az immunglobulin termelés irányításában. Az IL4/IL12 arány fontos szabályozója a Th1 és a Th2 T sejt differenciálódásnak, IL12 túlsúly esetén Th1, IL4 túlsúly esetén Th2 irányú immunválasz indul el. IL4: 5q31.1, 8996 bp, 153AA, 17492 Da, 63 fehérje kapcsolat, 227 SNP,www.genecards.org), és az IFN gamma (interferon) transzkripcióját és a limfociták proliferációját.

ETEC adherencia

TibA fehérje (enterotoxigenic invasion locus B): az ETEC törzsek (O78:H11 H10407) kromoszomálisan kódolt non organellum adhéziós virulecia faktora. Külső membrán fehérje. Az ileocoecalis és colon enterocitákhoz történő adherenciában és invázióban játszik szerepet, 988 AA-ból álló autotransporter. Növeli a biofilm képződést és a TibA-TibA interakció révén a baktériumok aggregációját.  A vonatkozó gének két lokuszban, a tia (enterotoxigenic invasion locus A)  és a tib (enterotoxigenic invasion locus B) területeken helyezkednek el. Négy gén, a tibA, B, C, és D szükséges a TibA fehérje termeléséhez.

A TibA fehérje expressziója összefüggést mutat az ETEC törzsekben a plazmidon kódolt fimbriális adhezin CFA/I fehérjével.

 A protein homológiát mutat az AIDA-I fehérjével is.

A TibC a TibA glikozilációját irányítja. Korábban kérdéses volt, hogy a bakteriális fehérjék esetén történik-e glikoziláció? A TibA volt az első E. coli-ban felismert glikoprotein. A glikoziláció gátlása megszünteti a TibA adherenciát és inváziót irányító képességét. A jelenlegi elképzelések szerint az ETEC fertőzések során észlelhető vizes hasmenés enterotoxinok hatására jön létre. Jelenleg úgy gondolják, hogy a TibA által létrehozott szoros kontaktus a baktérium és a gazdasejtek között lehetővé teszi a toxin efffektív bejuttatását a sejtekbe.

InvazivitásI

(Elsinghorst EA, Kopecko DJ. Molecular Cloning of Epithelial Cell Invasion Determinants

from Enterotoxigenic Escherichia coli. Infect Immun 1992, 60, 2409-2417)

Intracellular spread gene A (IcsA, vagyVirG: virulencia): aktin alapú motilitási faktor, az intracellularis terjedésben szerepel. Az IcsA 1102 AA-ból álló autotransporter, a virG gén kódolja, több plazmidon is jelen van (pWR100, pMYSH6000, pINV_F6_M1382, pCP301). A Shigella flexneri és a EIEC törzsek intracelluláris terjedését segítő virulencia faktor. Elősegíti a filamentosus actin poláris depozicióját és a kórokozó actin mediálta motilitását. Az emlős sejtekben elidítja az autophagiát az APG5L proteinhez kötődve (autophagy protein 5 like, 275 AA, a FADD- fas-associated protein with death domain proteinhez kötődve autophagiát és apoptozist indukál. Az APG12-vel kapcsolodva membrán lefűződéseket, autophagosomákat alakít ki). Az IcsB-vel interakcióba lépve az autophagia védekező rendszeréből való szabadulást is irányítja. ATP kötő, gyenge ATP-ase aktivitású. Komplexbe lép az ARP3/3-al és az NWASP (neural Wiskott-Aldrich syndrome protein) fehérjével és elindítja az actin molekulák összegyűlését. A vinculinnnal (profilinnal, cofilinnel, Cdc42-vel) is kapcsolódik, ami az actin molekulák toborzásában tölt be lényeges szerepet. A vinculin (VCL) citoszkeletális fehérje, részt vesz a sejt-sejt és sejt- mátrix junctio kialakításában. Az F- aktin membránhoz való rögzülését és a sejtfelszíni E-cadherin expresszióját riányítja. Szerepet játszik a sejtmorfológia és sejtmozgás alakulásában. A vinculin és az alpha catenin funkcionálisan rokonságban állnak egymással. 10q22.2, 122047 bp, 1134 AA, 123799 Da, 3 fehérje izoform, 193 fehérje kapcsolat, 1393 SNP (www.genecards.org).

A protein transzportja SecA függő. A belső membránon való áthaladáskor a signal peptid lehasad, a fehérje a periplazmikus térbe irányítódik. A C-terminális translocator domain (béta domain) a külső membránba inzertálódik, béta hordó strukturát képezve hidrofil pórust alakít ki, amelyen át a passanger domain (alpha domain) a baktérium sejt felszínére kerül. Itt az extracelluláris rész lehasad a IcsP (intracellular spread protease vagy SopA) enzimatikus hatására és a fragmens az extracelluláris térbe jut. A hasadás az IcsA polarizált eloszlásában alapvető. Az IcsA polarizált, gradienst alkotó elhelyezkedése actin álványzat felépüléséhez vezet. A kialakult actin farok segíti a kórokozók intracelluláris mozgását, és hozzájárul a baktériumok  intercelluláris terjedéshez, valamint  a membránok áttöréséhez.

A fehérje három domainből épül fel, az N terminális szignál szekvenciát tartalmazóból, a középső alfa részből, mely glicin gazdag ismétlődéseket és N-WASP kötőhelyet tartalmaz, és egy C terminális domainből, amely a membránban való lehorgonyzódást biztosítja és autotranszporterként is működik. A középső, alfa domain a baktérium sejt felszínén exponálódik. Az N-WASP kötődése mellett még több protein pl. Arp2/3 (actin releated protein) komplex, prophyllin, kapcsolódása vezet az F-aktin molekulák gyülekezéséhez és az aktin polimerizációhoz, amely a baktériumok körül kialakuló aktin farok felépüléséhez szükséges. Az Arp 2/3 komplex az evolúció során konzervatívan megörződött hét polipeptidet tartalmazó struktúra és térszerkezete hasonlít a konvencionális aktinhoz, innen származik az elnevezése is. Az Arp 2/3 komplex alapvető funkciójú az aktin átrendeződésben, közvetíti a phylopodiumok és lamellopodiumok kialakulását, valamint résztvevője a mikrobiális aktin farok létrejöttének. Az komplex biokémiai aktivitása vezet az aktin szálak mintegy 70 fokos szögben történő keresztkötéséhez, valamint az aktin mag képződéséhez. Az aktin nukleáció részben az Arp2/3 komplex, részben a WASP protein család, részben a filamentozus aktin hatására alakul ki.

Az N-WASP mutációja Wiskott-Aldrich syndromát okoz (veleszületett, elsősorban a sejtes immunitás zavarával, ekcémával, thrombocytopeniával járó tünetegyüttes, amelyet visszatérő - Gram- negatív bakteriális, gombás és vírusos - fertőzések jellemeznek. A betegség nemhez kötötten öröklődik; fiúkban jelentkezik. Általában már a születést követő hónapokban jelentkezik. Tünetei csecsemőkori véres hasmenés és elhúzódó vérzések (a vérlemezke-hiány miatt), visszatérő fertőzések, és ekcéma. Az IcsA C terminális domainje autotraszporterként funkcionál. Az autotraszporterek V-os típusú szekréciós rendszerek, amelyek úgy működnek, hogy az N terminális vezető peptid átjuttatja a fehérjét a belső membránon, a C terminális domain pórust képez a külső membránban, amelyen azután áthalad az ún. utas (passanger) domain és kijut a baktérium felszínére.

A felszínre jutott autotranszporterek különféle módon processzálódnak. Egyrészük a sejtfelszínre jutás után lehasad és az extracellulris miliőbe kerülnek (EspP). Más autotranszporterek esetén a lehasadást követően a passanger domain a baktérium sejt felszínén marad, a béta domainekhez nem kovalens kötések révén rögzülve (pertactin, AIDA-I, Ag43). Más passanger domainek esetében nem történik hasadás és membránhoz kötött állapotban maradnak (Hia, Haemophilus influenzae adhesin). A passanger domainek lehasadását a sejtfelszínen végezhetik membrán kötött proteázok, de történhet autoproteolítikusan is. Az IgA1 (Neisseria gonorrhoeae immunoglobulin A1 protease),a Hap (Haemophilus influenzae autotransporter protein), az App (adhesion and penetration protein, Neisseria meningitidis fehérje), illetve az AIDA autoproteolitikusan hasad (részletek az autotranszportereknél), az IcsA (VirG) nem tartalmaz proteáz motívumot, az IcsP (vagy SopA, S. flexneri outer membrane protease, OmpT homológ fehérje) membrán proteáz működése révén hasad. A periplazmikus és a külső membrán fehérjék degradációját végző enzimatikus mechanizmusok nem teljesen ismertek. A periplazmikus enzimek közül a DegP, Q (Deg, degradation, multifunkcionális proteáz és chaperone, Gram+ és Gram- baktériumokban jelen lévő család, degradálja a misfolded és aggregált proteineket, másnéven HtrA (heat shock regulated protein A vagy protease Do) és a külső membrán protease OmpT vesznek részt ebben a folyamatban. A külső membránon való áthaladást végző energia transzport sem tisztázott minden részletében. A periplazmikus térben nincs jelen sem ATP, sem GPT, és nem sikerült proton hajtóerőt sem megfigyelni. Jelen vannak azonban az autotranszporter családok egy részében P-loop nukleotid motívumok. Nem sikerült azonban az ezekhez kötődő nukleotidokat megismerni. Ellentmondásos a protein foldingból eredő energia transzporthoz történő felhasználásának szerepe is.

Vas felvételi rendszerek

(Crosa JH, Mey AR, Payne SM. eds. Iron transport in bacteria. ASM Press, American Society of Microbiology, Washington DC, USA, 2004, Crowley DE, Wang YC, Reid CPP, Szaniszlo PJ. Mechanisms of iron acquisition from siderophores by microorganisms and plants.Plant and Soil, 1991, 130, 179-198,Neilands JB, Siderophores: Structure and function of microbial iron transport compounds J Biol Chem, 1995, 270, 45, 26723-26726, Carniel E. The Yersinia high-pathogenicity island: an iron-uptake island. Microbes and Infection, 3, 2001, 561−569, Stork M,Di Lorenzo M, Mourin S, Osorio CR, Lemos ML Crosa JH. Two tonB systems function in iron transport in Vibrio anguillarum, but only one is essential for virulence.  Infect Immun 2004, 72, 7326–7329).

A vas transzportban részt vevő számos fehérje közül több virulencia tényezőként szerepel a patogén coli törzsekben.

A vas ionok alapvető fontosságúak valamennyi élőlény számára. Szükségesek az energiatermelő folymatokhoz, a respirációhoz, a DNS szintézishez. Minden baktérium és gomba tartalmaz vas indukálta transzport géneket, amelyek között a siderophor receptorokat, a membrán transzport rendszereket, a siderophorok bioszintézisét és degradációját végző enzimrendszereket, valamint az ezeket reguláló fehérjéket kódoló gének szerepelnek.

A siderophorok kis molekula tömegű vegyületek, a baktériumok termelik és szekretálják őket. Ezek a struktúrák sequestrálják a vas tartalmú molekulákat, a ferritint (a ferritin FTH, ferritin heavy polipeptid 1, nehéz és könnyű láncokból álló 24 alegységből felépülő vasraktározó fehérje. Az alegységek összetétele szabályozza a szövetek vasfelvételét és vasleadását. A ferritin solubilis, non-toxicus állapotban tárolja a vas ionokat. A funkcionális forma 12 nm átmérőjű gömb, központi üreggel, amelyben az insolubilis vas deponálódik. 11q13, 7943 bp, 183 AA, 21226 Da, 42 fehérje interakció, 80 SNP) vagy a transzferrint (TF, monomer, szérum vas transzport glikoprotein, a bélből valamint a hem degradáció helyéről a vasat ferri formában szállítja a reticuloendothelialis rendszerbe, a májba, és a proliferáló sejtekhez. Szerves anyagokat - polleneket és allergéneket - is képes megkötni a keringésben és részt venni az eltávolításukban. 3q22.1,33051 bp, 698 AA, 77064 Da, 48 fehérje kapcsolat, 551 SNP, www.genecards.org), nagy aktivitással chelálva a vas molekulákat. Több mint 500 siderophort írtak le. A siderophorok a vassal hexadentát, vagy oktahedrális stabil komplexet képeznek.

Három fő siderophor típust ismertek meg, a hydroxamát, a catecholat és a kevert típust.

A hydroxamát típusúak a desferrioxaminok (De), a fuzarininek (C), az omnibactin, az aerobactin, a coprogén, a rhodotoulic sav, a ferri- chrom, a ferri- oxamin stb. A catecholatok közé tartozik az enterobactin, a bacillibactin, a vibrobactin stb.

Kevert típusú siderophor az azobactin, a pioverdin, a yersiniabactin stb.

A catecholat és a hydroxamát típusú siderophorok más receptor és transzport rendszereken kerülnek be a baktrérum sejt citoplazmájába.

Az enterobactin catecholat típusú siderophor, szintéziséhez és transzport rendszeréhez mintegy 16 gén szükséges. Hét a siderophor termelésében, nyolc pedig a ferri- enterobactin transzport proteinek termelésében vesz részt. Valamennyi gén negatív regulátora a Fur (ferric uptake regulation) protein, egy vaskötő fehérje, ami gátolja a többi fehérje expresszióját.

A ferri- hydroxamát siderophorok transzportjában is több membrán és periplasmikus protein, a FluB, C, D (flu /fluorescence/ gene, újabban agn, antigén 43 kódoló gén) vesz részt. A kódoló gének kromoszómális lokalizációjúak. A vas transzport porteinek génjei elhelyezkedhetnek plazmidokon is, pl. a pColV plazmidon található az aerobactin és transzport rendszerének gén clustere. Három további gén terméke a TonB, ExbB, és ExbD fehérje, amelyek E. coli cytoplasma membrán proteinek, amelyek a /membrán protonmotive force pmf/ proton energiát a TonB-hez kapcsolják. A TonB azután továbbítja az energiát nagy affinitású külső membrán transzport fehérjékhez. Az ExbD a TonB konformáció változását katalizálja az energia átvitel során. A fehérjék alapvető fontosságúak a ferri- enterobactin, a ferri- hydroxamát, a ferri- dicitrát és a B12 transzport rendszer működésében.

A vas transzportban résztvevő receptorok egy része a TonB (transport protein, T one) fehérjével kapcsolt, ún. TonB dependens receptor. Ez a fehérje a béta barrel fehérjék családjába tartozik, átíveli a belső membránt és a periplasmikus teret, és a külső membránban kapcsolódik a siderphor receptorokhoz. A belső membránban az ExbB, és D stabilizáló fehérjékhez kötődik. A TonB az előzöekben említett módon közvetíti a belső membránon belül keletkező proton fluxus energiáját a külső membrán siderophor receptorai felé. A siderophorok és az általuk megkötött fémionok a porin csatornákon kedvezőtlen permeábilitási tulajdonságaik, vagy alacsony környezeti koncentrációjuk miatt nem tudnának keresztül jutni. TonB protein hiányában a siderophor receptorok ugyan képesek a szubsztrát molekulák megkötésére, de aktív transzport nem történik. Számos receptor/transporter képes a TonB-vel kapcsolódni, ilyenek a BtuB (cianocobalamin, B12 transzporter), CirA (cathecolat típusú ferri ion transzporter – iron, és vas regulált colicin 1 receptor, porin), FatA (plazmidon kódolt ferri- anguibactin mediált transport rendszer), FcuT, FecA (ferri citrate transport gene), FhuA, G (ferri hydroxamate uptake gene), FepA (ferrienterochelin és colicin B és D cognate receptor protein), FtpA (ferri-enterobactin receptor gene), HemR (Yersinia hem receptor gene), IrgA (iron regulated gene A), IutA (iron uptake), PfeA (P. aeruginosa ferri-enterobactin receptor), PupA (ferri-pseudobactin 358 receptor, Pseudomonas putida WCS358 törzs), Tbp1, 2 (transferrin-binding proteins 1, 2) vas transzporterek.

A siderophorok számára szolgáló membrán receptorok bakteriofágok és bakteriocinek kötőhelyéül is szolgálnak.

 A baktériumok a környezetből a vasat több mechanizmussal képesek felvenni.

A vas transzport rendszereket a mikroorganizmusok közül az E. coli baktériumban tanulmányozták a legkiterjedtebben.

A coli törzsekben több vas transzport rendszer működik. Jelen van alacsony affinitású vasat transzportáló rendszer és több, ún. vas stressz által indukálódott magas affinitású transzport rendszer.

A mikroorganizmusok, így az E. coli is képesek a vasat nem siderophor mediált és siderophor mediált vas transzport rendszeren felvenni.

A nem siderophor mediált rendszerek egyike a ferri-dicitrát transzport rendszer, amely alacsony vas koncentráció mellett citrát jelenlétében indukálódik.

A másik a Fe2+ transzport rendszer.

A siderophor transzport rendszer a mikroorganizmusok által termelt nagy affinitású, vas biochelator vegyületek termelődésén és szekrécióján alapul. Ezek a vegyületek a solubilis Fe3+ vasat legerősebben kötő vegyületek közé tartoznak.

Az E. coli baktériumok a saját maguk által termelt siderophorokon kívül más mikroorganizmusok siderophorjait is képesek felhasználni. Saját siderophorjaik képesek továbbá más mikroorganizmusok siderophorjából, illetve más vas transzport proteinekből, hemből a ferri ionokat átvenni. A siderophor- TonB komplexből a periplazmikus térbe való bekerülés után a citoplazmába történő átjutást további transzporterek végzik. Ilyenek a FepB, C, D, G, amelyek a ferri- enterobactin transzportját, a FecB, C, D, E, amelyek a ferri- dicitrát, és az FhuB, C, D transzporterek (ferric hydroxamate uptake), amelyek a ferri- hydroxamát citpolazmába juttatását végzik.

A siderophorok képesek más fémek megkötésére is, ilyenek az alumínium, gallium, króm, réz, cink, ólom, mangán, kadmium, vanádium, plutónium, és urán.

A siderophorokat és receptoraikat a humán medicinában is alkalmazzák pl. fémek által okozott toxicus állapotokban, vagy politranszfundált betegek vas terhelésének csökkentésére, infekciózus állapotokban antibiotikumok baktérium sejtbe juttatására. Felhasználják a siderophorokat a mezőgazdaságban is.

Az E. coli és a Shigella virulencia faktora többek között az aerobactin, egy hydroxamát típusú siderophor, amely expresszálódik az E. coli több törzsében, a S. flexneriben és S. pneumoniae-ben. Az aerobactin struktúráját tekintve 1,6-di (N6)-acetil-N6-hydroxilisine citrát.

A baktériumok vasfelvételében résztvevő további gének az iucA, B, C, D, és iutA (iron uptake transport, aerobactin A receptor).

rt systems of Escherichia coli for ferrienterobactin, ferriaerobactin, ferric-dicitrate, and the ferric-hydroxamate

srophores, ferrichrome, ferrioxamine B, coprogen, and rhodotorulic acid. See text for explanation. Figure used by

Shu rendszer (Shigella hem uptake): a vas és a haem felvételében szerepel számos patogénben, így az E. coli O157:H7-ben, a Yersiniák-ban, V. cholerae-ben, Haemophylus influensae-ban. N. meningitidis-ben, Shigellák-ban.

A baktériumokban két hem felvételi rendszer működik koordináltan, az egyik irányítja a hem és a hem tartalmú fehérjék kötődését a külsö membrán receptorokhoz, a másik a hemophorok szekrécióját végzi. Az utóbbiak hemoproteinekkel lépnek kapcsolatba és prezentálják azokat a specifikus receptorok felé.

A Shu gén locus komponensei a ShuA, amely hem receptort kódol és ez irányítja a hem felvételét és bejutását a periplazmába. A ShuT periplazmikus kötőfehérje, amely solubilis receptorként megköti a hemet és közvetíti a citoplasmába való bekerülést. A Shu U és ShuV citplazmikus membrán permeáz és ATP-áz, mely elősegíti a hem átjutását a citoplazmába. A Shu S citoplazma szolubilis fehérje, amely a hem raktározását végzi a citoplazmában az aktív hem transzport idején és DNS-hez kötődő proteinként megvédi a DNS-t a hem mediálta oxidatív károsodástól.

UPEC vasfelvételi rendszerek

Aerobactin: vonatkozó gének iucA, B, C, D (iuc: iron uptake cluster), és iutA. Hydroxamát típusú siderophor, a TonB dependens vas transzport rendszer tagja. A siderophor coli törzsekben,  Shigella flexneri, K. pneumoniae törzsekben is megtalálható.

 

Chu: E. coli hemin uptake. Vonatkozó gének chuA, S, T, U, W, X, Y. A chuA 69 kD-s külső membrán proteint kódol. A gén egy nagyobb locus, a hem transzport locus része, mely széles körben megtalálható patogén E. coli törzsekben.

A hem és a hemoglobin vasforrásként történő felhasználása előnyös a citotoxinokat szekretáló patogén törzsek számára, mert a szöveti invázió helyén az intracelluláris hem rezervoirokat is megnyílnak, amelyeket a kórokozók szintén képesek felhasználni.

Enterobactin. Vonatkozó gének: entA, B, C, D, E, F, fepA, B, C, D, E, G. Az enterobactin igen effektív vas kelátor, az Fe3+ iont 6 catechol oxigén veszi körbe és fém chelatot képez 3 negatív töltéssel. Szerkezetét tekintve 669 kD-s catecholat, amelyet az E. coli és a S. typhimurium szintetizál. A siderophor a ferri- enterobactin receptor (protein) A-hoz kötődik (FepA), amely 724 aminosavból álló külső membrán protein és a periplazmába transzportálja a ferri- enterobactint. A többi protein Fep B, C, D, G a transzport rendszer része a citoplazmába történő továbbítás során.

IroN: vonatkozó gén iroN. Az E. coli és a Salmonella enteritica enterobactin siderophor egyik receptora és a baktériumok virulencia faktora.

Rezisztencia mechanizmusok

(Richard H, Foster JW. Escherichia coli glutamate- and arginine-dependent acid resistance systems increase internal pH and reverse transmembrane potential.  J Bacteriol. 2004, 186, 6032–6041, Alba BA, Gross CA.Regulation of the Escherichia coli  sigma E–dependent envelope stress responseMolecular Microbiology 2004, 52,  613–619, Hofmann N,  Wurm R, Wagner R. The E. coli anti-sigma factor rsd: Studies on the Sspecificity and regulation of its expression. PLoS ONE 2011, 6 (5), e19235).

Az acidikus rezisztencia lényeges tényező valamennyi enterális kórokozó E. coli baktérium számára, mert át kell jutniuk a gyomor savas környezetén.

Az átlagos gyomor pH 2,0, az ürülési idő 2 óra. A savérzékeny pathogének esetén nagyobb csíraszám szükséges az infekció kialakulásához, így a V. cholerae esetén 10-100 millió kórokozó, a savrezisztens coli és shigella törzsek esetén azonban 10-100 baktérium is elégséges lehet az eredményes átjutáshoz, a bél colonizációjának kialakításához és a betegség létrehozásához. Az E. coli savrezisztenciája vetekszik a H. pylori-éval.

A coli baktériumok számára négy mechanizmus biztosítja az acidikus rezisztenciát. Ezek a következők.

A sav indukálta oxidatív rendszer (AR1, acid induced resistance system 1), a sav indukálta glutamát dependens rendszer (AR 2), a sav indukálta arginin dependens rendszer (AR 3) és a sav indukálta lysin dependens rendszer (AR 4).

Az AR1 mechanizmus az oxidatív, glukózzal gátolható rendszer, stacioner fázisban indukálódik. Az indukcióhoz szükséges fehérjék az rpoS (rpo, RNS polimeráz), alternatív sigma faktor, a cAMPR (cAMP receptor protein, katabolikus génaktiváló szabályozó fehérje) protein és további strukturális elemek. A részletes mechanizmus tisztázatlan.

Ha különféle stresszhatások pl. hő vagy más jellegű stressz éri a baktériumot, ezek károsíthatják a baktérium sejt különböző komponenseit. A sejtben különböző gének indukálódnak, amelyek termékei ellensúlyozzák a károsodást. Nagyszámú tanulmányt végeztek különböző károsodások érzékelésével és az erre adott válasszal kapcsolatban az E. coli törzsekben is. A Gram negatív baktériumoknak két kompartmentje különíthető el. A citoplazma, és a belső és külső membrán között található periplazmikus tér. Mindkét kompartmentben különböző stressz válasz rendszerek működnek. A sigma 32 dependens citoplazmatikus stressz válasz hő shock, illetve protein térszerkezeti változás (unfolded proteinek) indukálta stressz tényezők hatására indul el. A sejtfal stressz válasza, az extracitoplazmatikus stressz válasz is a citoplazmában jelen lévő transzkripciós faktorokhoz kötött, a stressz szignál azonban a sejtfalban keletkezik. Interkompartmentális jelátviteli rendszer közvetíti a citolpazmatikus transzkripciós faktorok felé a jelet. Két, jól definiált sejtfal stressz válasz jelút ismert, az egyik az ECF (extracytoplasmic function) sigma faktor E, a másik a két komponensű CpxAR rendszer (legalább 50 gén 34 operonba rendeződve szabályozza az envelope proteinek megfelelő foldingjának érzékelését. (Price NL, Raivio TL. Characterization of the Cpx Regulon in Escherichia coli Strain MC4100. J. Bacteriol. 2009,191,1798-1815).

A sigma E faktor aktiválódása a periplazmikus térben felhalmozódó nem megfelelő térszerkezetű (unfolded) proteinek hatására indul el, főként az OmpC és OmpF expressziója fokozódik. A fehérjék C terminális domainje nem megfelelő térszerkezet felvétele esetén kötődik a belső membránban lévő DegS proteáz periplazmikus PDZ domainjéhez. A PDZ domain 80-90 aminósavból áll, három protein első betűjéből álló acronym (P: post synaptic density protein PSD95, D: Drosophila disc large tumor supressor Dlg1, és Z: zonula occludens 1 protein Zo1). A domain sok ezer ismert fehérjében található. A kötődés aktiválja a szomszédos domain enzimatikus aktivitását, amely elhasítja a membránban a szomszédságban elhelyezkedő, membránt áthidaló RseA (regulator sigma E A) anti-sigma regulátort, a periplazmikus 1-es hasítási helyen. Leválik a periplazmikus rész, amelyhez a solubilis minor sigma E társ represszor, az RseB kötődik. Ennek hatására a membránban az RseA túloldalán elhelyezkedő másik regulátor proteáz, az RseP (regulator of sigma E protease, vagy EcfE E. coli protease, a belső membránhoz rögzült zink metallo- proteáz, az Esigma /E/ polimeráz működése során keletkezik, vagy korábban YaeL) elhasítja az intramembránális második hasítási helyen az RseA-t. Az RseP YaeL az emlős site 2 proteázok ortológja, amely két integrált membrán transzkripciós faktort, az ATF6-ot és az SREBP-(sterol regulatory element binding protein)-t aktiválja. Az ATF6 az unfolded protein válasz /endoplazmás retikulum stressz válasz (UPR, unfolded protein response) alapvető regulátora az endoplasmás reticulum stressz során, az SREBP pedig a cholesterin bioszintézis génjeinek expresszióját és a zsírszövet differenciálódását szabályozza.

 Ezután a citoplazmikus oldalon szabaddá válik a sigma E dimer, de még mindig az RseA citoplazmikus részéhez kötött állapotban van. Az RseA-t ezután a ClpXP (serine protease aktivitású, ATP dependens proteindegradáló komplex, részt vesz a DNS károsodás javításában és a gén expresszió szabályozásában, pl. flagellum szintézis) teljesen degradálja. Ezután a sigma E dimer már képes kötődni az RNS polimeráz béta alegységéhez. A komplex ekkor a megfelelő promoter területekre kötődik és elindítja a túléléshez szükséges fehérjék szintézisét.

A fenti jelátviteli út a proteobacteriumok gamma subdiviziójában általános. Legtöbbjükben az rpoE, az rseA, B, C, operonba rendeződött. Így van ez az E. coli-ban is.

Az AR 2 rendszer stacioner fázisban indukálódik, extracelluláris glutamátot igényel. A rendszer strukturális komponensei: két glutamát decarboxylase izoforma, a GadA és B és egy feltételezett glutamát: gamma-amino vajsav (GABA gamma amino butyrate) antiporter, a GadC.

Az AR 3 növekedési fázis esetében extracelluláris arginin jelenlétében indukálható. Strukturális elemei az acid-inducible arginin decarboxylase, AdiA és az AdiC antiporter. Ez utóbbi kicseréli az intracelluláris dekarboxilációs végterméket az agmatine-t extracelluláris argininre.

Az AR 4 lizin dependens rendszer, amely a lizin decarboxylase enzim jelenléte következtében lizin dependens rendszer.

Az utóbbi három rendszer lényege, hogy aminosav dekarboxiláció révén intracellularis proton használódik fel. Kicserélő antiporterek révén a dekarboxiláció termékei új aminosav szusztrátra cserélődnek. Ilyen módon az intracellularis pH 2,0 körüliről 4,5 körülire emelkedhet.

Megfigyelték, hogy pH 2,0 -n az EHEC törzsek arginin dependens rendszere intenzívebb és nagyobb védelmet biztosít a törzsek számára, mint a közönséges E. coli törzsek rendszere. A glutamát dependens rendszer valamennyi coli törzsben azonos módon hatékony. Az oxidatív rezisztencia mechanizmus az alternatív rpoS sigma faktor működéséhez kötött, amely pH 2,5  alatt szabályozza a túléléshez szükséges gének expresszióját. A stacioner fázisban lévő baktériumok 1000x rezisztensebbek a sav hatásával szemben, mint az exponenciálisan növekedő organizmusok, és nem szükséges előzetesen alacsony pH alkalmazása a rezisztencia kialakulásához. Az O157 és nem O157 STEC törzsek pH 2,5 rezisztenciája 75-80%-os volt. Az rpoS gén mutációja befolyásolja a coli törzsek acidikus rezisztenciáját. Azt gondolják, hogy az O157 EHEC törzsek savi rezisztenciája az oka, hogy ezek a baktériumok már igen alacsony csíraszámban is képesek betegséget okozni. Ennek nagyobb jelentősége van a vízjárványok kapcsán, mert ilyenkor az organizmusok direkt módon lehetnek kitettek a gyomorsav hatásának. Az élelmiszerrel akvirált infekciók esetén a savi rezisztenciának valószinüleg kisebb jelentősége lehet, mert a baktériumok az élelmiszer komponenseken belül kevésbé lehetnek kitettek a direkt savhatásnak. Jelentősége lehet a savi rezisztenciának olyan tápanyagok esetében is, amelyek savi környezetben készülnek fermentációval, pl. fermentált kolbász, majonéz, joghurt, alma juice. Az említettt élelmiszerek mind ismert közvetítői az E. coli O157 fertőzéseknek. Érdekes megfigyelés, hogy a hőhatás fokozza az O157 törzsek savi rezisztenciáját, így a stressz hatásnak kitett életképes organizmusok nem kellően főtt vagy átsütött élelmiszerekben túlélésük esetén még jobban ellenállóak a gyomor savi környezetének, mint ilyen stressznek nem kitett állapotukban.

A tellurit (telR rezisztencia) rezisztencia gén (ter)

(Bielaszewska M, Tarr PI, Karch H, Zhang W, Mathys W.Phenotypic and molecular analysis of tellurite resistance among enterohemorrhagic Escherichia coli O157:H7 and sorbitol-fermenting O157:NM clinical isolates. J Clin Microbiol 2005, 43,452–454)

Az EHEC O157:H7 törzsek jellemző génje. A tellurit rezisztencia (rezistencia a toxicus tellurium oxy anion, TeO3, tellurittal szemben) gyakori, de nem feltétlen tulajdonsága az EHEC O157:H7 törzseknek. A székletből, tápanyagokból vagy a környezetből az O157:H7 törzsek izolálására az egyik szelekciós stratégia a cefixim-tellurit-sorbitol-McConcay agar, a CT-SMAC használata. Az EHEC O157:H7 TER-t a kromoszómális terZABCDEF cluster kódolja, amely jelentős homológiát mutat a S. marcescens R478-as plazmidján lévő ter clusterrrel. Az EHEC O157:H7 EDL933-as törzs két identikus ter gén clustert tartalmaz a 43-as és 48-as identikus O szigeteken belül. Ezek a serW (serin) és a serX transzfer tRNS génekbe integrálódtak. Az O 157 Sakai törzs a RIMD 0509952 csak egy ter clustert tartalmaz (SpLE1) a serX területére integrálódva. Az O szigetek a TER géneken kívűl még adherencia gént is tartalmaznak, a vas regulált A gén homológ adhezint (IHA Iron-regulated gene A /irgA/ homologue adhesin). Tellurit érzékeny O157:H7 törzseket is izoláltak Észak-Európában és az USA-ban is. A tel gének elvesztéséhez vezető mechanzimusok nem ismertek. Úgy gondolják, hogy a ter elvesztése csökkenti az EHEC törzsek virulenciáját.

A tellurit rezisztencia gén jelen van non O157 EHEC törzsekben (O113:H21) illetve enterotoxigén E. coli törzsekben is.

A tel gének funkcionális szerepe a baktériumokban nem ismert. A S. marcescens R478 plazmidja a ter gének mellett pórus kialakító colicint is kódol. Úgy gondolják, hogy az EHEC O157:H7 ter clustere is hasonló funkciót tölthet be, kompetíciós előnyt biztosíthat a törzs számára a polimikrobiális környezetben.

Szekréciós mechanizmusok

(Deane JE, Roversi P, Cordes FS, Johnson S, Kenjale R, Daniell S, Booy F, Picking WD, Picking WL, Blocker AJ. Lea SM. Molecular model of a type III secretion system needle: Implications for host-cell sensing. PNAS 2006,103,12529–12533, Henderson IR, Navarro-Garcia F, l Desvaux M, Fernandez RC, Ala’Aldeen D. Type V Protein Secretion Pathway: the autotransporter story. Microbiol Mol Biol Rev, 2004, 68, 692–744, Filloux A, Hachani A, Bleves S. The bacterial type VI secretion machine: yet another player for protein transport across membranes.  Microbiology (2008), 154, 1570–1583, Bitter W. Type VII secretionand the mycobacterial cell envelope Microbiology Today, 2011, May, 102-106, Bitter W, Houben ENG, Bottai D, Brodin P, Brown EJ, Cox JS, Derbyshire K, Fortune SM, Gao L-Y, LiuJ, Gey van Pittius NC , Pym AS, Rubin EJ, Sherman DN, Cole ST, Brosch R.Systematic Genetic Nomenclature for Type VII Secretion Systems. PLOS Pathogens, 2009, 5, 1-6,Tseng T-T, Tyler BM, Setubal JC. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BioMed Central Microbiology 2009, 9 (Suppl 1):S2).

A baktériumok szekréciós mechanizmusa effektor molekulák, fehérjék, enzimek, toxinok transzportját vagy transzlokációját jelenti a baktériumok belsejéből, a citoplazmából vagy a citoszolból a baktériumok sejtmembránján, sejtfalán keresztül a baktérium sejt felszínére illetve a kűlvilágba. Ez a funkció, illetve a szekretált molekulák alapvetőek a környezettel való kapcsolatban, a baktériumok adaptációjában, túlélésében.

A baktériumok szekréciós mechanizmusa alapvető szerepet játszik a virulencia determinánsok, így az adhezinek, toxinok, enzimek és a baktériumok motilitását irányító mediátorok baktérium sejt felszínére jutásában, illetve azok környezetbe való kikerülésében. A szekréciós folyamatok nemcsak a patogén baktériumok, hanem a nem patogén organizmusok számára is alapvetőek a környezethez való adaptációban. A Gram pozitív baktériumok egy plazma membránnal rendelkeznek, a citoplazmikus membránnal, amit egy vastag sejtfalréteg vesz körül. A Gram negatív baktériumok kettős membránrendszerrrel rendelkeznek, van egy belső, a citoplazmát körülvevő citoplazmikus membránjuk és van egy külső membránjuk, amelyek szendvicsként fogják közre a peptidoglikánt és a periplazmikus teret. A belső membránon keresztül történő szekréciót mind a Gram negatív, mind a Gram pozitív baktériumok azonos mechanizmusokkal azonos utakon végzik. Ezek közé tartozik a Sec (secretion) dependens út, vagy másnéven az általános szekréciós út (GSP General Secretory Pathway), valamint az újabban azonosított Tat (twin-arginine signal peptide-dependent protein translocase, Tat translocase) és SRP (signal recognition particle) utak. A belső membránon való átjutást követően a transzlokálódott fehérjék sorsa különböző lehet. A gram pozitív baktériumokban a proteinek vagy az extracellularis környezetbe kerülnek, vagy a sejtfalba inkorporálódnak különböző peptid horgony mechanizmusokkal. A Gram negatív baktériumok belső membránján való áthaladás után a fehérjék a periplazmikus térbe jutnak. Innen a sejtfelszínre vagy az extracellularis térbe való kerüléshez szükséges a további barrieren, a külső membránon keresztűl történő szekréció. A Gram negatív baktériumokban ehhez további szekréciós mechanizmusok alakultak ki, néhány közülük függetlenedett a Sec dependens rendszertől és magában foglalja mind a belső, mind a külső membránon keresztűl történő transzportot. A baktériumokban eddig hét speciális szekréciós rendszert találtak.

Az ATP kötő kazetta típusú transzporterek előfordulnak az élővilág minden domainjében. A citoplazma membránon történő transzportot szignál peptiddel rendelkező fehérjék esetében a Sec és a Tat rendszerek végzik. A Sec rendszer konzervatívan megőrzött szekréciós rendszer, ami N terminális szignál peptid jelenlétéhez kötött a secretálódott proteinen. Más proteinek a plazmamembránon a Tat (twin-arginine translocation pathway- dupla arginin transzlokációs út) rendszeren keresztűl transzlokálódnak. Ennek a rendszernek a sajátja, hogy a Sec rendszertől eltérően, ami unfolded porteineket transzlokál, a térszerkezetet felvett, folded proteineket juttat át a membránon. A Gram negatív baktériumokban a Tat transzlokáz három esszenciális fehérje alkotó részből, a Tat A, B, C fehérjékből áll. A Tat rendszer működését legkiterejdtebben az E. coli baktériumban tanulmányozták. A három protein egy operonról expresszálódik, egy negyedik protein a TatD irányításával. Az operonhoz tartozik egy ötödik fehérje, a TatE, ami TatA homológ, alacsony mennyiségben termelődik és funkciója nem teljesen ismert. A Gram pozitív baktériumokban nincs jelen TatB, csak TatA és C. A TatA bifunkcionális és betölti a TatB szerepét is. A Tat út neve két konzervativ arginint tartalmazó motívum jelenlétéből származik, amely az N terminális szignál peptid részben helyezkedik el. A szignál peptidase eltávolítja a szinál peptidet, miután a fehérje transzportálódott a Tat rendszeren keresztül. Nem minden baktérium genom tartalmazza a tatA, B, C, géneket. Nincs különbség a patogén és nem patogén törzsek között a gének jelenlétében. Több virulencia faktor transzportálódik a Tat rendszeren keresztül. Az E. coli O157:H7 törzs teljes virulenciája különöböző infekciósus modellekben függvénye a teljesen funkcionáló Tat rendszernek.

I.  típusú szekréciós rendszer, Type I secretion system, T1SS vagy TOSS

A baktériumok belső és külső membránján történő transzportot az ABC trnaszporterekhez hasonló transzport mechanizmusok végzik. A transzporterek legegyszerűbb változata három protein alegységből felépülő, a belső membránt, a periplazmikus teret és a külső membránt áthidaló csatornaképző protein rendszer. A belső membránt áthidaló tag ABC kazetta kötő protein, a periplazmikus teret áthidaló közbülső fehérje a membrán fúziós protein (MFP membrane fusion protein), a külső membránt pedig a külső membrán fehérje (OMP outher membrane protein) hidalja át, egymással összekapcsolódva közös csatornát képeznek. Egy folyamatos csatornáról van szó a citoplazmatikus belső oldal és az extracellularis térrel határolt külső oldal között. A rendszer nem hoz létre periplazmikus intermedier képződést. A  belső membrán és a periplazmikus komponensek szubsztrát specifikusak, a külső membrán komponens, a TolC (tolerance to colicin) sok transzport rendszer részét képezvén számos szubsztrát transzportjában vesz részt. Az I-es típusú szekréciós rendszer 20-900 kD méretű molekulákat, ionokat, gyógyszereket, proteineket szekretál. Az E. coli kisméretű toxicus hatású peptideket is szekretál a transzport mechanizmuson keresztül pl. a colicin 5-t (10kD). RTX (repeats in toxin, ismétlődő szekvenciákat tartalmaznak, haemolysinek, leukotoxinok) típusú toxinok és enzimek, pl. lipázok, illetve nem protein típusú struktúrák, így  béta glucan és poliszacharidok is exportálódnak a rendszeren keresztül. A nagyméretű E. coli HlyA haemolysin (110 kDa, Sec független transzport mechanizmus) is az I. típusú szekréciós rendszeren keresztül szekretálódik.

A HlyA egy lipid modifikált protein, mely 11-17, 9 aminosavból álló, calcium kötő alegységből felépülő ún. repetitív domaint tartalmaz. Ez kapcsolatba lép az eukaryota sejtekkel és az interakció hatására pórust képez az eukaryota sejtek membránjában, amelyen keresztül citoplazma alkotó elemek távoznak el a sejtből. A HlyA E. coli haemolysin belső membrán transzportere a HlyB2, ATP kötő kazettát tartalmaz. A HlyB2 és HlyD működése energia igényes. Az ATP hidrolízis a HlyB, HlyD dimérek összekapcsolódásához szükséges. A TolC egy periplazmatikus, hosszú alfa hélix alagutból és a külső membránon áthatoló béta láncokból álló, csatornaformáló részből épül fel. Az alfa helikális alagút 30 A  átmérőjűre nyílik a HlyD-vel való kapcsolatba lépés után. Miután a HlyA tanszportja megtörtént, a három komponens szétválik.

II.  típusú szekréciós rendszer, Type II secretion system T2SS vagy kétlépésese protein szekréció, Two step type II protein secretion

A II-es típusú szekréciós rendszer hasonló a szex pílusok felépülési mechanizmusához, szubsztrátjai folded proteinek. Minden II-es típusú rendszer legalább 12 különböző komponensből áll, amelyek áthidalják a periplazmikus teret.

A II –es típusú szekréciós rendszer az általános szekréciós út fő terminális része (MTB Main Terminal Branch), az ún. sec-dependens szekréciós szisztéma. A fehérjék transzportja Sec vagy a Tat rendszeren keresztül először a periplazmikus térbe történik, ezt követően a II-es típusú rendszer révén a külső membránon keresztül jutnak ki az extracellularis térbe. A teljes szekréciós rendszert közel 30 fehérje építi fel, amelyek a belső és a külső membránban helyezkednek el. A külső membránban egy multimer, 12-14 alegységből összeálló pórust képző komplex jön létre, a secretin fehérjék komplexe.

Többféle secretin komplex konfiguráció elmélet született. Ezek közül a legnépszerűbb, hogy a D protein monomerek oligomerizálódva gyűrűt képeznek és egy centrális csatornát építenek fel. A C terminális végük a külső membránba ágyazódik. A secretin D proteinnel homológiát mutató fehérjék vesznek részt a III. típusú szekréciós út felépítésében is. A secretin E kináz aktivitású, és ez az energiaszolgáltató alegység a pilinszerű alegység struktúrák, a G és K proteinek összeépüléséhez és transzlokációjához. Ezek a proteinek homológiát mutatnak a IV-es típusú pilusokat felépítő fehérjékkel és úgy gondolják, hogy e proteinek pseudopílust alakítnak ki. Ezeknek a fehérjéknek a processzálásában és metilálásában az O fehérje, a prepilin peptidáz vesz részt. Az S protein lipoprotein és stabilizálja a külső membránba inzertálódó, D proteinekből felépülő struktúrát. A belső membránban és a periplazmikus térben ezekkel a secretin proteinekkel összekapcsolódva 10-15 fehérje helyezkedik el és építi fel a teljes szekréciós apparátust. Sokuk funkciója még nem tisztázott. A Gram negatív baktériumok 4-es típusú pílusai biogenezisük során a II. típusú szekréciós rendszer működésével épülnek fel, és bizonyos proteinek közösek a pílus komplexben és a II. típusú szekréciós rendszerben.

A proteineket a pílus dugattyúszerű mozgással extrudálja. A II-es típusú szekréciós mechanizmussal szekretálódó fehérjék N terminális szignál szekvencián keresztül jutnak át a belső membránon, a signál peptideltávolítása után bekövetkezik a korrekt folding és az érett peptid felszabadulása a periplazmikus térbe. A II-es típusú rendszer működése specifikus, képes különbséget tenni  a secretálódó és a rezidens periplazmikus fehérjék között.

Az E. coli-ban a type II szekréciós rendszer alegységeit GSP (general secretion pathway) A-O-ként jelölik.

A II-es típusú szekréciós apparátus a pO157 plazmidon is jelen van és a Ler transzkripcionális aktivátor hatására is expresszálódik. A plazmidon kódolt rendszer működésére példa a II. típusú szekréciós rendszeren szekretálódó, a pO157 plazmidon kódolt, EHEC törzsekben jelenlévő virulencia tényező, a szekretált C1 esterase inhibitor proteáz, az StcE (secreted C1 esterase inhibitor /INH/ protease). A szekretálódott proteáz specifikusan hasítja C1 INH fehérjét. Ez az inhibitor protein alapvető szabályozója a klasszikus és az alternatív complement aktivációnak, az intrinsic alvadási útnak és az alvadás kontakt aktivációjának. A C1 esterase inhibitor (serping 1, serpin peptidase inhibitor clade G/ C1 inhibitor/member 1, nagyfokban glikozilált, az aktivált C1R és C1S complement komponenseket gátló fehérje, hiánya herediter angioneurotikus oedemat –HANO- okoz. Kapcsolódik az E. coli membrán StcE fehérjéhez, megvédve a baktériumot a complement mediálta lizistől.11q12-q13.1, 17300bp, 500AA, 55154 Da, 25 fehérje kapcsolat, 9 alternatív splice mintázat, 11 exon, 130 SNP)  inaktivációja megszünteti a complement kaszkád lényeges kontroll lépését. Ezáltal hozzájárul a szöveti károsodáshoz, az intestinalis oedema képződéséhez és a thrombotikus citopéniához.

III. típusú szekréciós rendszer, Type III secretion system T3SS, TTSS

A rendszer egy molekuláris fecskendő bonyolult felépítésű fehérjekomplexe, amely több baktérium törzsben, így E. coli EHEC, Salmonella, Shigella, Vibrio, Yersinia baktériumokban vannak jelen A következő patogének rendelkeznek ezzel a szekréciós rendszerreel: Yersinia spp. Salmonella enteritica serovar typhimurium, S. flexneri, EHEC, EPECE. coli, B. pertussis, C. trachomatis.

A struktúra alkotó elemei homológiát mutatnak a baktérium csillók basalis testével (bacterial flagellar basal body). A citosol alacsony calcium koncentrációja nyitja ki a TTSS kaput. A Y. pestisben (ebben a baktériumban karakterizálták elsőként ezt a rendszert) írták le az lcrV (low calcium response V) fehérjét, amely érzékeli a calcium koncentráció csökkenését és megnyitja a TTSS-t.  A TTSS rendszer az E. coli törzsekben (pl. EHEC, EPEC) a Tir (intimin receptor) gazdasejtbe juttatásáért felelős. Általában ez a rendszer a használatos mechanizmus a patogén mikrobák esetében toxinok és farmakológiailag aktív fehérjék gazdasejtbe juttatására. Ezek a rendszerek a baktériumokban az eukaryota sejtekkel történő kontaktus során aktiválódnak.

A T3SS fehérjék három csoportba oszthatók. Strukturális fehérjék (az alapot, a belső pálcát és a tűt felépítő fehérjék), effector fehérjék (a gazda sejtbe szekretálódnak és elősegítik a fertőzés kialakulását) és chaperonok (a baktérium citoplazmában kötődnek az effector fehérjékhez, megakadályozzák aggregálódásukat és degradációjukat és a tű komplex felé irányítják őket).

A T3SS fehérjék elnevezése az egyes baktérium törzsekben

Yersinia

Yop: Yersinia outer protein

Ysc: Yersinia secretion (component)

Ypk: Yersinia protein kinase

Salmonella

Spa: Surface presentation of antigen

Sic: Salmonella invasion chaperone

Sip: Salmonella invasion protein

Prg: PhoP-repressed gene

Inv: Invasion

Org: Oxygen-regulated gene

Ssp: Salmonella-secreted protein

Iag: Invasion-associated gene

Shigella

Ipg: Invasion plasmid gene

Ipa: Invasion plasmid antigen

Mxi: Membrane expression of Ipa

Spa: Surface presentation of antigen

Osp: Outer Shigella protein

Escherichia

Tir: Translocated intimin receptor

Sep: Secretion of E. coli proteins

Esc: Escherichia secretion (component)

Esp: Escherichia secretion protein

Ces: Chaperone of E. coli secretion

Pseudomonas

Hrp: Hypersensitive response and pathogenicity

Hrc: Hypersensitive response conserved (or Hrp conserved)

Több törzsben

Vir: Virulence

A T3SS rendszer néhány kulcsfontosságú fehérjéjének szerepe és jelölése a baktérium törzsekben (WIKIPEDIA).

 Funkció

Shigella

Salmonella

Yersinia

Escherichia

Tű alkotó fehérje monomer

MxiH

PrgI

YscF

EscF

Belső pálca

MxiI

PrgJ

YscI

EscI

Tű hegy fehérje

IpaD

SipD

LcrV

EspA

Translocator

IpaB

SipB

YopB

EspD

Translocator

IpaC

SipC

YopD

EspB

Translocator chaperone

IpgC

SicA

SycD

CesD

ATPáz

Spa47

InvC

YscN

SepB (EscN)

A fehérjék pozícióját irányító protein

Spa32

InvJ

YscP

Orf16

Kapcsoló

Spa40

SpaS

YscU

EscU

Kapuőr

MxiC

InvE

YopN (TyeA)

SepL

 

A szerkéciós rendszer komponensei: intracitoplazmatikus (InrC) (ATP kötő, ATP-áz aktivitású) OrgB dimer, SpaO. Az SpaO kapcsolódik a belső membránban lévő SpaP, Q, R, S, InrA komplexel, a PrgK fehérjével. Periplazmatikus helyzetű a PrgH, külső membránban lévő az InvG dimer, és extracellularis a Prgl komponens.

A TTSS által szekretált fehérjék

A III-as típusú szekréciós rendszer által transzlokált egyik fehérje az EPEC és EHEC törzsekben a lambdoid profágon kódolt cycle-inhibiting factor (CIF), amely a cyclin dependens kinase 1 inaktivációja révén gátolja a sejtciklus G2-M fázisának tranzícióját. Szintén a rendszer transzlokálja az EspA proteint, amely a III-as típusú transzlokációs apparátus  extracellularis komponense, filamentozus struktúrát képez a baktérium sejt felszínén és fizikai kontaktust képez a baktérium sejt és az infektálódott eukaryota sejt felszíne között. A kapcsolat az A/E léziók kialakulásának korai sátdiumában jön létre. Az EspA fehérje szükséges az EspB és D transzlokációjához. Az EspB szintén a III-as típusú szekréciós rendszer révén kerül át a gazdasejtbe. Az EspA az EspD-vel együttesen pórust képez a gazdasejt membránjában, amelyen keresztűl más effektorok is behatolnak a gazdasejtbe. Az EspF szintén a III-as típusú szekréciós rendszeren keresztűl kerül be a gazdasejtbe. Ez 206 aminosavból álló protein, amely három azonos prolin gazdag szekvenciát tartalmazó ismétlődő régiójával hasonlóságot mutat az SH3 domaint tartalmazó eukaryota szignalizációs fehérjékkel. Ez az effektor fehérje csökkenti a tight junction integritását, megváltoztatva az occludin tight junction asszociált fehérje sejten belüli redisztribucióját. Az EspF fehérje ezen kívűl apoptozist indít el. Az EspG szintén a III-as típusú szekréciós rendszer által szekretált fehérje, szekvenciája hasonlít az espC-hez, a patogén sziget orf3 génjéhez (EPEC törzsekben van jelen) és a VirA fehérjéhez (Shigella törzsekben található). Az EspH szintén a III-as típusú transzlokációs rendszer porteinje, amely a filopodiumok és az alapzat struktúra kialakításában vesz részt.

A MAP mitokondrium-asszociált fehérje szintén a III-as típusú transzlokációs rendszer szekretált proteinje (EPEC) és a gazdasejtek mitokondriális membránjának potenciálját töri szét és hozzájárul a filopodium kialakuláshoz.

NleA/EspI (non-locus-of-enterocyte-effacement-encoded effectorA) a III-as típusú transzlokációs rendszer fehérjéje, amely elkülönülten helyezkedik el a LEE régiótól és a profág asszociált patogén szigeten belül kódolódik az EHEC genomban. A protein jelen van az EPEC törzsekben is.  Az NleC (non-locus of enterocyte-effacement encoded effector C) szintén a III-as típusú transzlokációs apparátus fehérjéje és ez is részt vesz a citoszkeleton átrendezésben. Az NleD fehérje is a rendszer által transzlokálódott protein és szintén a citoszkeletális átrendeződésben tölt be patogén szerepet.

A TTSS a baktérium és a gazdasejt sejtfelszíni kontaktusának hatására aktiválódik. Felépítését tekintve a TTSS egy külső tű- szerű részből, transzmembrán domainből és cytoplasmaticus hagymaszerű részből áll (ipaA, B, C, D, ipgC, ipgE). Együttesen ezt injekciós tű komplexnek nevezik.

A tű sejtfelszínnel való kontaktusában az ipa B és C vesz részt, a kontaktus egyrészt aktin polimerizációt, másrészt caspase aktivációt és apoptosist okoz. Az ipgD és az ipa molekulák bekerülnek a gazdasejtbe (rövidítések: ipg –invasion plasmid gene, spa-surface presentation of invasion plasmid antigen, mxi-membran excretion of ipa).

Funkcionális szempontból az mxi-spa (type III secretion system, TTSS) rendszer mintegy 20 fehérjét szekretál. Legnagyobb mértékben az ipa A, B, C, D, és ipgD molekulákat. A TTSS rendszer nemcsak protein szekréciót, hanem bizonyos virulencia plazmidon lévő target gének transzkripcióját is irányítja, pl. a virA és az ipaH 9.8-ét. Ezek a fehérjék nem szintetizálódnak állandóan, a baktériumok citoplasmájában tárolódnak. Expressziójuk jelentősen fokozódik a szekréciós rendszer aktiválódásakor.

A rendszert kódoló gének (Mxi, ipa, ipg, ics, spa gének) és a termelődött fehérjék funkciója:

IpaB és ipaC chaperon fehérjék: Nem szekretáló feltételek között az ipa B és az ipaC a bakteriális citoplazmában akkumulálódik és a két fehérje egymástól függetlenül asszociálódik az ipgC-vel. A TTSS rendszer tű részét ilyenkor az ipaB és ipaD fehérjékből álló dugasz zárja el. Az ipgC szintén chaperon fehérje és megakadályozza az ipaB és ipaC aggregációját. A szekréció során az ipaB és ipaC komplex a gazdasejt membránjában pórust képez és elindítja a gazdasejtben az aktin polimerizációt, valamint a caspase aktivációt. A póruson keresztül bekerül a gazdasejtbe az ipgD és az ipaA molekula.

ipgB (invasion plasmid genes): funkciója ismeretlen

ipgA: az icsB stabilizációjához és szekréciójához szükséges molekula.

ipgE: az ipgD molekula chaperonja

ipgF: valószínűleg a sejtfal degradációját segíti elő az Mxi-Spa apparátus felépülésekor.

MxiG: belső membrán fehérje, amely az injekciós fecskendő komplex alapját építi fel.

MxiH: a fecskendő komplex egyik fő proteinje, az Mxi H alegységek helikális struktúrába rendeződnek és cilindrikus szerkezetet alkotnak középen, a vezető csatornában.

MxiI: a tű komplex komponense

MxiJ: az MxiG-ase enzimmel a fecskendő komplex alapjának kialakításában vesz részt.

MxiN: az MxiK-val interakcióban az Spa47 ATP-áz-hoz kapcsolódik és elősegíti a tű rész 

MxiH és MxiI komponenseinek a tű rész felépítéséhez jutását.

MxiL: ismeretlen funkciójú chaperon molekula.

MxiM: külső membrán lipoprotein, ami az ipa szekréciójához szükséges és részt vesz a baktérium inváziójában és intracellularis terjedésében. Stabilizálja az MxiD expresszióját és elősegíti a nagy molekula tömegű MxiD beépülését a külső membránba.

MxiD: az ipa fehérjék szekréciójához, és a baktérium inváziójához szükséges molekula, az

MxiM stabilizációs hatására részt vesz a külső membránban kialakuló pórus képződésében. C terminális része amphipaticus béta lemez struktúrákból áll.

MxiE: a TTSS rendszer által szekretált faktorok post inváziós reguláló fehérjéje.

MxiC: ismeretlen funkciójú coiled-coil domaint tartalmazó szekréciót szabályozó fehérje

MxiA: ipa szekrációt és inváziót elősegítő fehérje, valószínűleg részt vesz a belső membrán pórus kialakításában és a citoplazmatikus lokalizációjú ipa számárta dokkoló struktúra.

Spa15: solubilis acidikus protein, a baktérium inváziójához nem szükséges.

Spa47: ipa szekrécióhoz és invázióhoz szükséges ATP-áz aktivitású fehérje, az ipa szekrécióhoz szükséges energia biztosításában játszik szerepet.

Spa13: ipa szekrécióhoz és invázióhoz szükséges fehérje, mobil szekretoros protein

Spa32: a tű rész hosszát szabályozó fehérje, átkapcsolja a type III szekréciós apparátus specifitását a tű komponensek szekretálódásáról az ipa fehérjék szekréciójára.

Spa24: az ipa szekrécióhoz, az invazivitáshoz és az intracellularis terjedéshez szükséges fehérje, mobil szekretoros protein.

Spa9: az ipa szekrécióhoz és az invazivitáshoz szükséges, a belső membrán pórus része és a citoplazmatikus ipa dokkoló struktúrája.

Spa29: az ipa szekrécióhoz és invázióhoz szükséges, részt vesz a belső membrán pórus kialakításában és a periplazmikus híd képzésében.

Spa40: részt vesz az ipa szekrécióban és az invázióban, a belső membrán pórus része

Spa33: szekretált protein, részt vesz az ipa szekrécióban és az invázióban, mobilis elemként szabályozza az ipa lokalizációját a TTSS-n belül.

ipaA (invasion plasmid antigens): elősegíti a baktérium internalizációját, kötődik a vinculinhoz, és aktin depolimerizációt idéz elő. A vinculin egy struktúr fehérje, ami részt vesz az aktin-citoszkeleton sejtmembránnal való keresztkötődésében, a fokális adhezios komplex részeként. Az ipa A –vinculin kapcsolódás fokális adhezin szerű struktúrák kialakulását indítja el, amely szükséges a baktériumok hatékony inváziójához.

ipaD: regulálja az ipa fehérjék szekrécióját és az ipaB-vel komplexben elzárja a tű csatorna részét, ezzel kontrollálja a fehérjék áramlását.

ipaC: az ipaB/C komplex inzertálódik az epithel sejtek membránjába, pórust képez, vagy transzlokátor struktúrát, amelyen keresztül bekövetkezik az effektor fehérjék injektálása a sejtbe. Aktin polimerizációt és philopodium képződést indít el a baktériumok epithel sejtbe való belépése során A gazdasejt citoplazmája felé exponálódott ipaC  C terminális domainje kiváltja az aktin nucleációt/polimerizációt a cdc 42 és a rac aktiváció elindításával. Az aktin nucleáció úgy következik be, hogy az ipa C C terminális domainje protein komplexet képez az N-WASP fehérjével és az actin nucleator ARP2/3 proteinnel. Ez a szekvenciális aktivációs folyamat vezet a philopodiumok, majd a lamellopodiumok kialakulásához.

ipaB: kapcsolódik az APC/anaphasis promoting complex-vel, gátolja a sejtciklus progresszióját, ennek révén elősegíti a bél epithelium bakteriális colonizációját. Kötődik a CD44 sejtfelszíni struktúrához, a hialuronsav receptorhoz. A kötődés kialakulása lipidtutaj függő és ez a kulcslépése a baktériumok átmeneti sejtfelszíni adherenciájának, amely azután aktiválja a szekréciós apparátust. A fehérje az ipaD-vel komplexben eldugaszolja a tű részt és gátolja a proteinek áramlását. Az ipaB az ipaC-vel komplexben inzertálódik a gazdasejt plazma membránjába és pórust alakít ki. Ugyanez a komplex, az ipaB és C szükséges ahhoz is, hogy a baktérium áttörjön a fagocita vacuola falán, amikor a baktérium már a vacuolában bejutott a gazdasejt belsejébe. Az ipaB kötődik továbbá monociták, makrofágok és dendritikus sejtek caspase 1 fehérjéjéhez és ennek következtében aktiválja proinflammatorikus IL1B és IL18 felszabadulását, és idukálja a monocita/makrofág sejtek apoptózisát. Az IL18 proinflammatorikus citokin, elősegíti a Th1 sejtek IFN gamma termelését. 11q22.2-q22.3, 20867 bp, 192 AA, 22326 Da, 23 fehérje kapcsolat, 290 SNP,www.genecards.org).

IcsaB: a TTSS rendszeren keresztül szekretálódik, a baktériumok felszínén lokalizálódik és közreműködik a baktériumok postinvazív patogenicitásában. A molekula mutációja a gazdasejten belüli terjedés károsodását okozza. Az icsaB alapvető szerepe az icsaA molekula elrejtése a gazdasejt autophag védekező rendszere elől. Az icsaA célmolekulája az autophag vacuolum kialakulását irányító egyik fehérjének, az ATG 5-nek (autophagia 5, vagy VPS vesicular protein, másnéven beclin). Az autophagia egy újabban felismert intrinsic védekezési rendszer, amely az intracellularis baktériumok felismerését és eliminációját végzi.

Az autophag vacuolumokban csapdába ejtett baktériumokat a lizoszómával való fúzió degradálja. Néhány kórokozó, pl. Streptococcus pyogenes, S. flexneri. L. pneumophila stb. bizonyos mechanizmusokkal képes a destukciót elkerülni Ilyen az icsB fehérje és a bakteriális IV típusú szekréciós rendszer.

IpgD (invasion plasmid gene). Inositol 4-phosphatase aktivitása révén defoszforilálja a phosphatidil inositol 4-5 bisphosphatot és phosphatidil inositol 5 monophosphattá alakítja. Lekapcsolja a subcorticalis citoszkeletális aktin vázat a sejtmembránról.

VirA:. A VirA alfa/béta tubulin heterodimerhez kapcsolódik és mikrotubulus destabilizációt okoz. Ez a RhoA inaktiválása révén aktin átrendeződést okoz. Előidézi a RAC1 aktivációját, amely RAC1 –Irsp53(insulin receptor tyrosine kinase substrate p53) -WAVE2 (WASP family Verprolin-homologous protein, PIP3 /phosphphatidylinositol (3,4,5)-trisphosphate/ kötő, Wiscott-Aldrich szindróma proteinhez hasonló /WASP/ ARP2,3 kötő fehérje, 5 WASP fehérje ismert) komplex felépülését indítja el, amelyhez azután az ARP 2,3 kapcsolódik. Végeredményben ez indítja el az aktin átrendeződés folyamatát. Microtubulus destabilizáció jön létre, ami membrán kitüremkedések kialakulásához vezet és elősegíti a baktériumok behatolását a gazdasejtbe.

IpaH7. 8: elősegíti a baktériumok kiszökését a makrofágok fagocita vacuolumából.

IpaH9. 8: a nucleusba transzlokálódó protein, funkciója közelebbről nem ismert.

OspG: a veleszületett immunapparátus működését gátló fehérje ubiquitin konjugáló enzim aktiválása révén.

A TTSS rendszer gazdasejtekre gyakorolt pathogén hatásai: caspase aktiváció, apoptózis indukció, gyulladás gátlás, aktin átrendeződés. 

IV.  típusú szekréciós rendszer, Type IV secretion system T4SS, TFSS (type four secretion system)

A IV típusú szekréciós rendszer hasonló a konjugációs rendszerhez. A konjugációs rendszer egy igen promiszkuus DNS cserélő mechanizmus, amelyben a DNS a donor sejtből a recipiens sejtbe kerül. A mechanizmus sejt-sejt kontaktust igényel és kifinomult membrán fehérje szuperstruktúra kialakulásához kötött. Néhány patogén olyan szekréciós rendszert alkalmaz az effektor proteinek eukaryota sejtekbe való bejuttatására, amelynek alegységei az evolúció során a konjugációs rendszerből alakultak ki.

A lényegét tekintve ez is a belső és a külső membránokat, valamint a periplazmikus teret áthidaló fecskendőszerű multiprotein komplex, amely homológ a baktériumok konjugációját irányító komplex struktúrával és az Archaea-k flagelláival. Ezek a struktúrák alkalmasak a DNS, és az előzőhöz hasonlóan a fehérjék transzportálására is. Eredetileg az Agrobacterium tumefaciensben fedezték fel, amelyben ez a rendszer képes volt a Ti plazmid T-DNS részét átjuttani a növényi gazdasejtbe, amelynek révén az érintett területen tumor alakult ki.

A transzferhez szükséges pílus felépülésében a Vir fehérje rendszer tagjai, VirA, VirB1-11, VirD1-4, VirE és VirG vesznek részt. A VirB2 a pílus fő alegysége, a VirB4 és 11 belső memebrán fehérjék, a VirD4 citoplazmikus protein, ATP-ase aktivitással rendelkeznek.

A későbbeikben a TFSS rendszert észlelték a Helicobacter pylori-ban. Ez juttatja be a CagA fehérjét a gyomor epithel sejtjeibe. A Bordetella pertussis ezzel a rendszerrel szekretálja a pertussis toxint a légúti epithel sejtekbe, a Legionella pneumophila szintén ezzel juttatja az icm/dot gének (intracellular multiplication/ defect in organelle trafficking genes) fehérjéit a pneumocytákba. A T4SS-en szekretált IcMF protein szükséges a baktérium makrofágokban történő replikciójához.  Ez a protein megtalálható a T6SS rendszerben is. A TFSS a sec rendszerrel is kapcsolatban áll.

V.  típusú szekréciós rendszer, Type V secretion system, T5SS

Ezek az ún. autotranszporter rendszerek, amelyeken keresztül többek között az EAEC törzsek patomechanizmusában szerepet játszó SPATE típusú fehérjék szekretálódnak. A fehérjék a citoplazma membránon és a belső membránon a Sec rendszeren keresztűl jutnak át. A periplazmikus térből a külső membránon a fehérjék úgy jutnak át, hogy C terminális részük inzertálódik a külső membránba és egy pórusformáló béta hordót képezve lehetővé teszi a fehérjék ún. passanger domainjének kijutását a sejt külső felszínre. Ezt követően az autotransporter fehérjék elhasadnak és a bétahordó rész a külső membránban marad, a passanger domain leválik és kijut az extracellularis térbe. Úgy gondolják, hogy a porinok ilyen autotranszporter bétahordó remnantok.

Az V-ös típusú protein szekréciós rendszer a Sec rendszeren a periplazmikus térbe került proteinek külső membránon történő átjuttatását végzi. Három változatuk ismert, az Va rendszer vagy autotranszporter rendszer (AT1), a kétpartneres szekréciós rendszer, az Vb és az újabban leírt Vc rendszer vagy AT2. Az Va rendszer esetében a passanger domain egy linker régióhoz kötötten kerül a baktérium sejt felszínére, az Vb mechanizmus során a passanger domain szekretálódik az extracellularis térbe, az Vc rendszer esetében egyidejűleg több passanger domain és egymához kapcsolódott linker régió kerül a molekula felszínére.

Az autotranszporteres szekréciós út (Va típus) elsőként a gonococcus IgA1 proteáz, illetve ennek extracelluláris része szekréciójával kapcsolatban került leírásra. A proteáz szekréciója a következőképpen történik. A protein 169 kD-s prekurzorként szintetizálódik, három funkcionális domainje az N terminális leader szekvencia, amely a belső membránon való áthaladást biztosítja, a C terminális helper rész, amely felépíti a külső membránban a bétahordó struktúrát és ezen keresztűl kijut a külső felszínre extracelluláris pozícióba az IgA1 proteáz aktivitású középső rész. Az IgA1 proteáz az aktív konformációt az extracellularis transzport során veszi fel, majd autoproteolízis révén lehasad a membránról. A solubilis, ún. proforma változat tovább hasad egy 106 kD-s IgA1 proteáz változattá és egy kis molekula tömegű stabil alfa proteinné. A kezdeti leírást követően számos bakteriális protein esetében felismerték, hogy ezen a transzport folyamaton keresztül szekretálódik. Az E. coli proteinjeinek szekréciója során a belső membránon való áthaladásban mind a Sec translocon, mind az SRP út részt vesz. A Sec út során a SecB molekuláris chaperon segíti elő a preproteinek SecA-val történő kapcsolódását, az SRP út esetén pedig a riboszóma- SRP komplex irányítja a transzláció során a preproteineket a transloconhoz.

A peripalazmikus tébe jutott proprotein intermedierek a külső membránon úgy haladnak át, hogy az első béta lemez áthalad a periplazmikus téren és inzertálódik a külső membránba, a fehérje passanger domainje időlegesen még a periplazmikus térbe nyúlik. A passanger domain komplett foldingja a kb. 2 nm átmérőjű bétahordó pórusán történő áthaladás után a sejtfelszínen következik be.

Az IcsA solubilis periplazmikus autotranszporter esetén figyelték meg, hogy a periplazmikus térben részleges folding következik be, amelynek következtében a fehérje parciálisan rezisztenssé válik a proteolítikus enzimek hasításával szemben. A fehérje periplazmikusan egy molekuláris chaperon funkciót betöltő DegP fehérjével kapcsolódik a szekréció előtt, valamint diszulfid kötések is kialakulnak a passanger domainben egy disulfid kötést létrehozó enzim (DsbA, disulfide bond-forming enzyme A) hatására. A béta domainek, az autotranszporterekben a külső membránban antiparallel elrendeződést felvéve alakítják ki a béta lemezeket és a béta hordót. Ezeket a bétahordó képző struktúrákat valamennyi integráns külső membrán fehérjében megtalálták. Az autotranszporterek C terminális része 250-300 aminosavat tartalmazó terület, amelyek szekvenciálisan nagyfokú diverzitást mutatnak, de abban konzekvensen megegyeznek, hogy mindegyik béta domain struktúrát alkot. A béta hordók pontos felépítése a különböző autotranszporterekben még nem ismert, de közös jellemzőjük, hogy valamennyi autotranszporter béta domainje 9-12 aminosavból álló, 14 amphipaticus (asszimetrikusan poláris), antiparalell láncból épül fel. Az extrém C terminuson valamennyi béta domain konszenzus aminosav motívumot tartalmaz, a terminális aminosav mindig fenilalanin vagy triptofán. Ezt megelőzően alternálva hidrofíl (töltéssel rendelkező vagy poláros) és hidrofób reziduumok (y/v/I/F/V)-X-(f/v) helyezkednek el. Ilyen motívumok találhatók a többi Gram negatív baktérium külső membrán fehérjéiben, pl. az E. coli porinjaiban is. Az első és az utolsó béta szál antiparallel inzerciója hidrogénkötésekkel zárja a gyűrű konformációt, és molekuláris pórust alakít ki. Az alternáló hidrofób aminosav oldalláncok a hidrofób lipid kettős rétegbe való beágyazódást teszik lehetővé, a hidrofil oldalláncok pedig a hordó közepén az aquosus környezetbe nyúlnak be. A lipopolisaccharid és a periplazmikus chaperon Skp (Seventeen kilodalton protein, DNS kötő, hiszton szerű fehérje, OMPH) szintén hozzájárul a külső membrán porinok (OmpA, PhoE- phosphoporin protein E trimer külső membrán pórusformáló fehérje) valamint az V-s típusú szekréciós mechanizmus pórusainak felépüléséhez. Az OmpA esetén három molekula Skp kötődik a porinhoz, amely 2-7 LPS molekulával lép interakcióba és biztosítja a porin megfelelő foldingját és inzercióját a külső lipid membránban.

A passanger domainek transzlokációja

Eredetileg úgy gondolták, hogy a passanger domain unfolded konformációban jut át a monomer bétahordó hidrofil csatornáján és a globularis konformáció nem kompatibilis a transzlokációs mechanzimussal. Az újabb vizsgálatok azonban azt mutatták, hogy a passanger domainek egy oligomer, minimum hat béta hordóból álló 2 nm átmérőjű póruson szekretálódnak, sőt azt is feltételezik, hogy 10 monomerből kialakuló gyűrű is létezik. Az ilyen méretű pórusok lehetővé teszik folded protein struktúrák áthaladását is.

Az autotranszporterek egy részében jelen van egy autochaperon domain is (pl. IgA1 peotease, IcsA), amely lehetővé teszi a proteinek megfelelő foldingját, majd a szekréció során az autochaperon domain lehasad.

Az autotranszporterek processzálása a sejtfelszínen

A felszínre jutott autotranszporterek különféle módon processzálódnak. Egyrészük a sejtfelszínre jutás után lehasad és az extracellularis miliőbe kerül (EspP). Más autotranszporterek esetén a lehasadást követően a passanger domain a baktérium sejt felszínén marad, a béta domainekhez nem kovalens kötések révén rögzülve (pertactin, AIDA-I, Ag43). Más passanger domainek esetében nem történik hasadás és membránhoz kötött állapotban maradnak (Hia- Haemophilus influenzae adhesin). A passanger domainek lehasadását a sejtfelszínen végezhetik membrán kötött proteázok, de történhet a hasadás autoproteolítikusan is. Az IgA1, a Hap (Haemophilus influenzae autotransporter adhesin protein), az App (adhesion and penetration protein, 160 kD, homológ a Hap fehérjével) illetve az AIDA (adhesin involved in diffuse adherence, később részletezve) autoproteolitikusan hasad, az IcsA (VirG) azonban membrán proteáz, az IcsP (SopA, Shigella flexneri outer membrane protease) révén. A periplazmikus és a külső membrán fehérjék degradációját végző enzimatikus mechanizmusok nem teljesen ismertek, de a periplazmikus enzimek közül néhány, a DegP (multifukcionális chaperon és protease, a belső membrán és a periplazmikus tér debaturált, aggregált fehérjéit hasítja, ahigh temperature requirement A HTRA protease család tagja, mint a DegQ és DegS), Q és a külső membrán protease OmpT részt vesznek a degradációban. A külső membránon való áthaladást biztosító energia transzport nem teljesen ismert. A periplazmikus térben nincs jelen sem ATP sem GPT, valamint nem sikerült proton hajtóerőt sem megfigyelni. Jelen vannak azonban az autotranszporter családok egy részében P-loop nukleotid motívumok, viszont nem sikerült az ezekhez kötődő nukleotidokat megismerni. Ellentmondásos a protein foldingból eredő energia felhasználása is a transzport során. Jelenleg az autotranszporter mechanizmus energia dependenciája ellentmondásos és spekulatív.

 

Vb típusú kétpartneres szekréciós út

 

A belső mebránon történő áthaladás szignál szekvencia irányításával történik. A periplazmikus térbe történő átjutás után a transzporter (C terminális) domain inzertálódik a külső membránba és béta hordót alakít ki. Ezt követően a passanger domain ezen keresztűl a sejt felszínére jut és további proteolítikus processzálás során nyeri el fiziológiai funkcióját. Az előzőekben leírt autotranszporter úthoz képest a különbség az, hogy ott a protein egy polipeptidként termelődik. A kétpartneres út esetén a pórusformáló béta domain (a transzporter domain, TpsB család, Tps- two partner secretion) és a passanger domain (exoprotein, TpsA család) két különböző proteinként szintetizálódik, a TpsA és TpsB protein család tagjai. Az autotranszporterekhez képest (Va típus) a bétahordó topológia is különböző. Ebben a rendszerben 19 amphipaticus béta szál alkotja a TpsB-t, szemben az autotranszporter bétahordó 14 béta szálával. A TpsB proteinek szerkezete sokkal komplexebb és részt vesznek a passanger domain aktív formába történő alakulásában is. Az egymásnak megfelelő exoporotein és transzporter protein közös operonban működik. A Tps rendszer specifikus felismerési mechanizmuson alapul, a TpsA N terminális, konzervatív domainjét a TpsB specifikusan felismeri, és ez indítja el a külső membránon át történő transzlokációját. Az autotranszporter úthoz hasonlóan a Tps út is nagyméretű, 100 kD feletti proteinek szekréciójában vesz részt. Úgy gondolják, hogy az exoproteinek unfolded konformációban jutnak a periplazmába és sejtfelszínre jutás közben fokozatosan veszik fel a megfelelő térszerkezetet. A transzlokáció mozgató erejének a folding kapcsán felszabaduló energiát tartják.

 

Az E. coli funkcionálisan jellemzett autotranszporterei

 

AIDA-I                      adherencia

IcsaA                          intracellularis motilitás

TibA                           adherencia, invázió

Ag43                          biofilm képzés

RGD szekvencia (Arg-gly-asp) aspartil protease

P-loop-ATP, GTP kötő motívum

Tsh                              haemoglobinase, mucinase, hem kötő, endopotidase, P-loop ATP kötő motívum

SepA                          szöveti invázió, endopeptidase

EspC                           enterotoxicus antivitás, endopoptidase

EspP                           citotoxicus aktivitás, endopeptidase, P-loop motívum

Pet                              enterotoxicus, citopathias, toxicus hatás, spectrin hasítás,P-loop                                        motívum  

Pic                              mucinase, endopoptidase

SigA                           citopathias hatás, endopeptidase

Sat                              vacuolizáló citotoxin, endopeptidase, P-loop motívum

Vat                             vacuolizáló citotoxin, endopeptidase, P-loop motivum

EpeA                          mucinolíticus, endopeptidase, P-loop motívum

EatA                           endopeptidase,

EspI                            plazma protein degradáció, endopeptidase, P-loop motívum

EaaA                          endopeptidase

EaaC                           endopeptidase

 

Vc típusú szekréciós rendszer

 

A polimer autotranszporter család (Oca család, oligomeric coiled-coil adhesins) típusosan a Y. pestis YadA (Yersinia adhesin A) oligomer autotranszportere. A fehérje hat domaint tartalmaz, N terminálisan szignál szekvenciát, fejet, nyakat, két közbülső és egy C terminális régiót, amelyben mindössze négy béta lánc található. Ebben a szekréciós rendszerben a béta hordó képződésben kiemelkedő szerepű a C terminális rész előtt található kapcsoló terület trimerizációval létrejött 12 béta szála, amely kialakítja a pórus formáló béta hordót, és ezen át jut a felszínre a trimer passanger domain. Analóg mechanizmussal kerül a felszínre a H. influenzae trimer adhesin proteinje, a Hia adhezin (Haemophilus influenzae adhesin).

Jelenleg a három féle V-ös típusú szekréciós rendszeren keresztűl szekretálódott ismert effektor molekulák száma több mint 1000, amelyek a GenBank-ban megtekinthetők.

Közülük funkcionális szinten relatíve keveset jellemeztek. Jelenleg ezeket 11 clusterbe csoportosították különböző programok (Tree és Clustalx) segítségével. Az E. coli (és a Shigellák) autotraszportereit a táblázatban összefogaltuk. A továbbiakban ezeket jellemezzük.

Az AIDA (adhesin involved in diffuse adherence) autotranszporter család. A hármas- négyes clusterhez tartozik. A legnagyobb autotranszporter család, jellemzője az AidA konzervált domain, amely 644 aminosavból áll, és a passanger és béta domainek között található. Számos patogén baktériumban is megtalálható az E. coli mellett. A család több mint 55 autotranszporterből áll, többek között az E. coli adhesin AIDA-I, a coli külső membrán protein antigén 43-ból, és a S. flexneri intracellularis motilitását segítő IcsA-ból.

Az AIDA-I 1286 AA-t tartalmaz, 2 fő része az AIDA I adhesin és AIDA-I translocator.

Korábban a klasszikus EPEC törzseket a szerotípusaik alapján klasszifikálták. Később a HeLa sejteken mutatott adherencia mintázatuk alapján a lokalizált adherenciát mutatók lettek a jelenlegi EPEC törzsek. A diffúz adherencia mintázatot mutató, korábban EPEC törzseknek tartottak a mai DAEC törzsek. Egyes törzsek lehetnek aggregatív mintázatott mutatók, ezek a mai EAEC törzsek. A különböző patotípusok különböző virulencia faktorokat tartalmaznak. Az egyik ilyen klasszikus EPEC törzs (2787, O12:H27) infantilis diarrhoeae-ből került izolálásra és diffúzan adherens mintázatot mutat a HeLa sejteken. Az adherencia mintázatért felelős gént a baktérium nagy plazmidján azonosították. A 6 kb-nyi fragmentumon két fehérjét, a 44,8 kD méretű Aah-ot (glikoziltransferáz, autotransporter adhesin heptosyltransferase) és a 132 kD méretű AidA-I-et azonosítottak. Az Aida-I bizonyult a diffúz adherencia phenotípus kialakításában a döntő tényezőnek. A protein szekréciója az autotranszporter szekréciós úton keresztül történik. A passanger domainje 79,5 kD, a béta domainje 47,5 kD méretű. A passanger domain bizonyos funkcionális jellemzői hasonlóak a coli felszíni protein antigén 43-hoz. A processzálás után a nem kovalens kapcsolódás révén továbbra is kötődik a baktériumsejt felszínéhez.

Mindkét struktúra tartalmaz 31 ismétlődő, 19-21 aminosavból álló konzervatív szekvenciát. Az AidA-I fehérje passanger domainje homopentamer, homohexamer struktúrákká aggregálódik. Az aggregáció strukturális alapját nagymennyiségű béta szál jelenléte képezi. A szekréció során az AidA-I fehérje posttranszlácionális módosuláson megy keresztül, amely a másik fehérje, az Aah jelenlétéhez kötött. Ez a fehérje homológiát mutat egy másik autotranszporter, glikozilációt végző proteinnel, a TibC-vel (enterotoxigenic invasion locus B, lásd az ETEC adherenciánál). Mindkét fehérjében jelen van a heptasyl transferázokra jellemző konszenzus szekvencia. Korábban úgy gondolták, hogy protein glikoziláció csak az eukaryotákban zajlik, de a közelmúlt vizsgálatai igazolták, hogy mind az Archaeak-ban, mind a baktériumokban megfigyelhető protein glikoziláció. Ez a folyamat észlelhető az AidA- I protein esetében is. A protein szénhidrát összetétele 10,7%, heptóz monosaccharidok kapcsolódnak 19:1 arányban a fehérjéhez. A glikolizációs hely a VXNSGGG repetitív terület. Az AidA-I HeLa sejtekhez való tapadása egy 119 kD-s sejtfelszíni fehérjén keresztül történik (gp119).

A DAEC törzsekben az AidA-I nincs jelen, valószínűleg AidA-I-hez hasonló autotranszporter fehérjék alakítják ki a diffuz adherencia mintázatot.

A sertések oedema betegségét létrehozó E. coli törzsek F18 és Stx2E struktúráinak expressziója együttesen fordul elő az AidA-I termelődésével.

Ag43 (antigen 43): a fehérjét a 70-es években figyelték meg SDS–PAGE és keresztezett immun elektroforézis alkalmazásával. A név onnan származik, hogy a 43-ik antigén volt, amelyet a coli külső membránjából készült membrán vezikulum elektroforézise során azonosítottak. Ez a molekula volt az első azonosított autotraszporter. Az Ag43 a sejt külső felszínén, nem kovalens kötéssel kapcsolódik az integrális külső membrán protein béta43-hoz, amely az autotranszporter membránban maradt béta domainje. A proteinben azonosították az RGD (arg-gly-asp) motívumot, amely az integrin kötő fehérjékben, pl. a fibronectinben is jelen van. A motívum alapján felvetődött a fehérje szerepe a baktériumok adheziójában. Az Ag43 a baktérium sejtek autoaggregációjában is részt vesz. Megfigyelték, hogy az Ag43 expresszió a biofilm képződés esetén jelentősen fokozódik. Jelenléte elősegíti különböző fágok, a lambda P1 és P4 bejutását a coli baktériumokba. Az E. coli O157:H7 törzsek felszínén az Ag43 fehérjével homológ struktúra, a Cah (calcium-binding and heat-extractable autotransporter protein) van jelen. A két struktúra közötti homológia 69%-os. A Cah szintén  az autoaggregációt és a biofilm képződést segíti elő.

Az oxydatív stressz hatására aktiválódó pozitív globális génregulátor, az OxyR az Ag43 expresszió erős represszora. Az ag43 transzkripcionális start helyén jelen lévő GATC szekvencia DNS metilációra érzékeny terület, a Dan (deoxi-adenosyne) metiláz a helyet metilálja, így megakadályozza az OxyR kötődését, így az Ag43 expresszió elindulhat. Az OxyR és a metilációs folyamat szabályozó hatása magyarázza az Ag43 expresszió különbségeit az egyes törzsekben.

IcsA (intracellular spread gene A) 1102 AA-ból álló autotransporter, a virG gén kódolja. Több plazmidon is jelen van (pWR100, pMYSH6000, pINV_F6_M1382, pCP301). A Shigella flexneri és a EIEC törzsek intracelluláris terjedését segítő virulencia faktor. Elősegíti a filamentosus actin bipoláris depozícióját és a kórokozó actin mediálta motilitását. Az emlős sejtekben elidítja az autofágiát az APG5L proteinhez kötődve. Az IcsB-vel interakcióba lépve az autofágia védekező rendszeréből való szabadulást is irányítja. ATP kötő, gyenge ATP-ase aktivitású. Komplexbe lép az ARP 2/3 és a NWASP (neural Wiskott-Aldrich syndrome protein) fehérjével és elindítja az actin molekulák összegyűlését. A vinculinnnal, profilinnal, cofilinnel, Cdc42-vel is kapcsolódik, amelyek az actin molekulák toborzásában töltenek be lényeges szerepet.

A protein transzportja SecA függő, és a belső membránon való áthaladáskor a signal peptid lehasad, a fehérje a periplasmikus térbe irányítódik. A C-terminális translocator domain (vagy béta domain) a külső membránba inzertálódik, béta hordó strukturát képezve hidrofil pórust alakít ki, amelyen át a passanger domain (alpha domain) a baktérium sejt felszínére kerül. Itt az extracelluláris rész lehasad a IcsP (SopA) enzimatikus hatására és a fragmens az extracelluláris térbe jut. A hasadás az IcsA polarizált eloszlásában alapvető. Az IcsA polarizált, gradienst alkotó elhelyezkedése actin állványzat felépüléséhez vezet, és az actin farok segíti a kórokozók intracelluláris mozgását, hozzájárul az intercelluláris terjedéshez, a membránok áttöréséhez.

A SPATE fehérjék

A SPATE fehérjék szekretálódó autotransporter proteázok.

Tsh (temperature sensitive hemagglutinin), plasmidokon kódolt (pAPEC-1, pAPEC-O2-ColV, pYA3432), 1377 AA (amino acid)-ból álló, 140 kD méretű fehérje. Az E. coli és a Shigella speciesek által termelt serin protease autotransporter családtagok (SPATE család, serine protease autotransporters of the enterobacteriaceae), hasonlóan más bakteriális proteázokhoz konszenzus szerin proteáz motívumot tartalmaznak. 1994 óta ismert, hogy a SPATE család részt vesz a különböző E. coli pathotípusok által okozott betegségek kialakulásában. Nem pathogén coli törzsekben SPATE-k jelenlétét nem mutatták ki. A SPATE fehérjék jelentős immunogenitást mutatnak és jelentős homológiájuk ellenére szubsztrát specificitásuk egymástól különbözik.

A Tsh volt az első, 1994-ben leírt SPATE, amelyet madár pathogén (APEC avian pathogenenic E. coli) E. coli törzsekben azonosítottak. Ezek a törzsek madarakban okoznak disszeminált fertőzést (perihepatitis, pericarditis, septicaemia). A fehérje hőmérséklet érzékeny haemagglutinin. A tsh gén a ColV típusú plazmidon a colicin V gén közelében helyezkedik el. A Tsh-t megtalálták emlős E. coli izolátumokban is. Az enzim hasítja a caseint és mucolytikus aktivitású. A hemoglobin mellett képes kötődni az extracelluláris matrix fehérjéihez is. Hozzájárul a fibrin depozitumok kialakulásához. Az adhesiv és a proteolytikus hatások a fehérje különböző domainjeihez kötöttek.

Ujabban sebfertőzésekből izolált E. coli törzsben is találtak a Tsh-val 99,9 %-ban azonos haemoglobin kötő protease-t (Hbp, haemoglobin binding protease). A hbp gén a Tsh-hoz hasonlóan szintén ColV típusú plazmidon kódolt. A Hbp protein részt vesz a hem környezetből történő felvételében, kapcsolatba lép a humán haemoglobinnal, degradálja a fehérjét és kötődik a felszabadult hem-hez. A Hbp azonban nem mutat heamagglutináló aktivitást, ebben a tekintetben különbözik a Tsh-tól.

Valamennyi SPATE szekréciója során a szignál peptid a belső membránon történő áthaladás során lehasad, az autotranszporter fehérje szakasz a periplazmikus térbe irányítódik. A C terminális transzlokátor domain ezt követően a külső membránba inzertálódik és hidrofil pórust lépez a membránban. A fehérje passanger domainje ezen a póruson keresztül további hasítás után a baktérium sejt felszínére kerül. A hasítást végző enzimek nem minden SPATE esetén ismertek.

SepA (Shigella extracellular protein, serin protease autotransporter) Shigella flexneri autotransporter, virulencia plazmidokon kódolt (pWR100, pCP301) 1364 AA-ból felépült fehérje. A SepA-t 1995-ben írták le. A fehérje homológ a Tsh-val és a S. flexneri egyik fő extracellularis fehérjéje. Ez is egy proteolyticus hatású autotransporter, amelynek szubsztrát spektruma részben hasonló a granulocyták által termelt catepsin G-hez (CTSG, a peptidáz S1 fehérje család tagja, a neutrophil granulocyták azurofil granulumaiban található, részt vesz a bekebelezett patogének elpusztításában és megemésztésében. Tripszin és kimotripszin szerű szerin proteáz enzim. Antibakteriális aktivitású, a Gram negatív baktériumokkal szemben, aktivitását az LPS gátolja. 11q11.2, 2743 bp, 255 AA, 28837 Da, 73 fehérje kapcsolat, 62 SNP, www.genecards.org). A sepA mucosa atrophiat és szöveti gyulladásos folyamatot okoz, részt vesz a szöveti invázióban. A fehérje szekréciója során bekövetkező lépések az előzőekben leírtak szerint történnek.

EspC (EPECserine protease,alternatív nevek: Per-activated serine protease autotransporter, enterotoxin EspC, serine protease EspC- EPEC-secreted protein C). Számos Escherichia coli  törzsben jelen van (O127:H6 strain E2348/69 / EPEC, Escherichia coli O157:H7 str., Escherichia coli M605,Escherichia coli B088, Escherichia coli O157:H7 str. 1125, Escherichia coli WV_060327,  Escherichia coli FVEC1412, Escherichia coli M605, Escherichia coli O157:H7 str. EC1212, Escherichia coli O157:H7 str. 1044).

Valamennyi EspC 1300 AA körüli fehérje.

EspC az EPEC törzsek egyik fő autotransporter fehérjéje, 110kD méretű. A protein szekréciója során  történő lépések az előzőekben említettekkel azonosak.

Attacing/ effacing léziokat okozó más baktériumokban is jelen vannak, azonban ezekben a fehérje nem szekretálódik. A fehérje az A/E léziót indukáló patogének virulenciájának egyik tényezője. Hasítja a fodrint, azonban nem idéz elő fodrin átrendeződést. Termelődését a perA transzkripcionális regulátor irányítja. Az irányító cascade egyik alapvető tényezője a Ler (LEE encoded regulator). Az espC gén az EPEC törzsek kromoszomáján kódolt. Az EspC fehérje nem teljesen tisztázott hatású, cytopathias effektust kiváltó enterotoxin.

EspP (E. coli EHEC törzsek serine protease P enzimjei), a pO157 plazmidon kódolt autotransporterek. Négy változata az alfa, 1248 AA, béta 1248 AA, gamma 1247 AA, delta 1247 AA-ból álló proteinek. A fehérjék az 0157:H7 (EHEC), O26:H-, O111:H-, ONT:-, O90:H8, O5:H-, O108:H25 törzsekből kerültek azonosításra (Uniprot adatbázis). A későbbiekben kimutatták az O111:H- törzsekben is. Az EspP-t 1997-ben írták le mint PssA fehérjét (protease secreted by STEC) az EHEC O157:H7 és az O26:H-, Shiga toxint termelő E. coli törzsekben. Hasonlóan más SPATE-khoz, ezek is kb. 104 kD méretű extracellularis fehérjék. Az EspP és a PssA biológiai aktivitása homológiájuk ellenére több tekintetben különböző. Az EspP hasítja a pepsinA-t és az emberi V-s alvadási faktort. Az V-s faktor degradáció hozzájárulhat a haemorrhagias colitis során kialakuló mucosalis vérzésekhez. A PssA szintén szerin protease aktivitású és cytotoxicus a Vero (verda reno, eszperantó, zöld vese) sejtekre. Proteolitikus aktivitása közrejátszhat a mucosalis infekció patogenezisében. A szekréció mechanizmusa azonos az előzőekkel.

Pic (protein involved in intestinal colonization) azEnterobacteriaceae család tagjai, aShigella flexneri és az enteroaggregativ E. coli által szekretált autotranszporter fehérjéje. Az Escherichia coliO44:H18 (strain 042 / EAEC),és E coli O6, Shigella flexneri (SigA) és UPEC törzsekben kerültek azonosításra. A fehérjemucinolytikus aktivitású, hemagglutinációt és a baktériumok szérummal szembeni rezisztenciáját közvetíti, továbbá részt vesz a bélrendszeri colonizáció létrejöttében. A proteáz fontos a bél mucus rétegének penetrációjában.A Pic volt az EAEC törzsekben másodikként azonosított SPATE tag. A Pic az EAEC törzsek kromoszomáján lokalizált. A fehérje azonos a shigellákban kimutatott Shmu (shigella mucinase) fehérjével, amely a shigella she (Shigella flexneri element, PAI, kromosomalis elhelyezkedésű, lateralisan acquirált, integrálódott patogenicitási sziget) területén lokalizált. A pic (she) gén egyedi az autotransportereket kódoló gének között. A Pic és a Set1 gének ugyanazon a kromoszómális locuson kódolódnak, de az ellenkező orientációjú DNS szálon. A Set1 A-B típusú enterotoxin (Shigella enterotoxin1), amely a S. flexneri 2A törzsben termelődik. Egy 20kD-os katalitikus A (setA génen kódolt) és öt 7kD-os B alegységből (setB génen kódolt) épül fel és toxicus hatása ionszekréció változással áll összefüggésben. Apic gént környező szekvenciák különböznek az EAEC és a Shigella flexneri törzsekben. A S. flexneri-ben a she PAI locus még egy másik SPATE-t, a SigA-t is kódolja (ez a Pet-hez hasonló autotranszporter, l. később). A she PAI mellett a S. flexneri 2A-ban jelen van még egy instabil, multiplex antibiotikum rezisztenciát közvetítő PAI szerű génterület és az újabban leírt aerobactin vasfelvételi rendszert kódoló Shi-2 PAI génsziget.

Újabban az UPEC törzsekből is izoláltak Pic homolog proteint (PicU), amelynek aminosav homológiája 96%-os a Pic-vel. A PicU is egy szekretált protease, amely hozzájárul a hólyag colonizációhoz és fokozott neutrofil infiltrációt vált ki a bél epitheliumban és a submucosában. A PicU a Vat és Sat autotransporterekkel együtt hozzájárul az UPEC törzsek patogeneziséhez. A szekréció mechanizmusa azonos az előzőekkel.

Sat (secreted autotransporter toxin) serine protease autotransporter, 1295 AA-t tartalmaz, 107 kD molekulatömegű. Az UPEC coli törzsekből (E. coli CFT O73) izolálták. A vonatkozó gén lokalizációja kromoszómális, a PAI II területén található. Általában az acut pyelonephritist okozó coli törzsekben van jelen. A Pet-hez hasonlóan serin protease aktivitású, cytopathias hatást gyakorol a Vero vesesejtekre, a HK-2 hólyag és a Hep2 sejtvonalakra. A sejtek elongációja, lekerekedése, leválása jön létre a sejtkultúrában. Sat hatására a hólyag és vesesejtekben vakuolizáció alakul ki. A Sat a felső húgyúti infekciók során kialakuló vesekárosodás patogenezisében szerepel. A szekréció mechanizmusa azonos az előzőekkel.

Pet (plasmid-encoded toxin) szintén szerinproteáz autotransporter, 1998-ban írták le az EAEC törzsekben, mint hőlabilis szekretált enterotoxint. A vonatkozó gén a 65 MDa méretű pAA2 plazmidon (aggregative adherence-related plasmid of EAEC strain 042 Escherichia coli O44:H18) az AAF fehérjét kódoló gén szomszédságában helyezkedik el. A proteáz 1292 AA-t tartalmaz, enterotoxikus és citotoxikus aktivitású. A citopátiás hatás kialakulásához szükséges a toxin gazda sejtbe történő internalizálódása. Ehhez a folyamathoz nem szükséges a szerin proteáz aktivitás. A Pet toxin a fodrin és a spectrin diszrupcióját előidézve citoszkeletális változásokhoz és az epithel sejtek lekerekedéséhez vezet. A szekréció mechanizmusa azonos az előzőekkel.

SigA-t eredetileg a she patogén sziget területén (kromoszómálisan) kódolt IgA protease szerű szekretált proteinként írták le. Orientációja a Pic-hez képest fordított. A SigA szekretált serin protease, amely citopátiás hatású a Hep2 sejtekre. Toxicus hatásai közé tartozik, hogy S. flexneri 2A fertőzés során stimulálja a folyadék akkumulációt a bélben. 1285 AA-t tartalmaz. A proteáz bontja a kazeint és a fodrint. A szekréció mechanizmusa azonos az előzőekkel.

Vat (vacuolating autotransporter toxin) azEnterobacteriaceae család1376 AA-t tartalmazó, 148,3 kDa molekulatömegű, PAI kromszómális területen a thrW tRNS gén szomszédságában lokalizált szerin proteáz autotranszportere.A Vat-ot uropatogén E. coli  CFT073 (UPEC), az E. coli O45:K1 (strain S88, ExPEC), neonatalis meningitist okozó E. coli RS 218 (NMEC) és az E. coli O1:K1 (APEC) törzsekben írták le. A Vat intracelluláris vakuolumok keletkezését indukálja. A citotoxikus hatás hasonlít a Helicobacter pylori  VacA toxinjának hatására.

A Vat75%-os homológiát mutat a Tsh hemagglutininnel (lásd korábban) és a H. pylori Vac A (vacuolation toxin, vakuolizáló hatású toxin) fehérjéjével. Úgy gondolják, hogy a Vat elősegíti az E. coli törzsek bejutását, majd túlélését a véráramban. Igazolódott, hogy invazív E. coli törzsekben nagyobb gyakorisággal van jelen a Vat protein, mind intestinalis, mind uroinfekcióval járó esetekben.

Az E. coli törzsekben azonosítottak néhány más SPATE-t is. Ezek közé tartozik az Eib A, C, D, E IgG kötő fehérje (E. coli immunglobulin binding protein, pl. ECOR-9 coli törzs), amelyet egészséges gyermekből izoláltak. A későbbiekben ezeket a fehérjéket T5SS Vc szekretált proteinként sorolták be. Az EibA, C egymással 99,4%-os azonosságot mutatott, valamint minkettő homológ az IgA1 proteázokkal, amelynek alapján úgy gondolják, hogy funkciójuk az immunglobulinok (az IgG Fc részéhez kötődnek) megkötése és degradációja. Két további SPATE családtag kapcsolatot mutat a LEE negatív STEC (EHEC) törzsek virulenciájával. Az EspI kromoszómálisan, a PAI lokusz területén inzertálodott gén és az E. coli O91:H- 4797/97 törzsben került szonosításra. A másik az EpeA(E. coli  /EHEC/ plasmid encoded autotransporter protease), az O113:H21 EH41 coli törzs nagy virulencia plazmidján (pO113) kódolt serin protease autotransporter faktor. Az Esp1 pepsint degradál, valamint emberi plazma jelenlétében az apolipoprotein A-1-t képes hasítani. Az Epe mucináz aktivitású és szintén képes a pepsin hasítására. Az Esp1 és az EpeA 58%-ban homológok.

Az ETEC törzsekben is találtak más autotranszporter fehérjét, az EatA-t (ETEC autotransporter A). Ennek specifitása a SepA-hoz hasonló. Ez az autotransporter is hozzájárul a mucosalis destrukcióhoz, leukocyta infiltrációhoz és a folyadék akkumulációhoz. Az autotransporter toxin jelenléte azonban csak járulékos szerepű és a virulenciát erősíti.

 

VI.             típusú szekréciós rendszer, Type VI secretion system, T6SS

A VI-s típusú szektréciós rendszert 2006-ban azonosították a V. cholerae-ben és a P. aeruginosa-ban, de a rendszer tagjait azóta megtalálták állati, növényi, emberi pathogénekben és tengeri baktériumokban. A rendszer több komponensű, komponenseit egy gén cluster kódolja, amely a különböző törzsekben különböző módon szerveződik. A cluster eredeti neve IAHP (IcmF / intracellular multiplication F/ - associated homologous proteins). A gén cluster terméke 12-25 fehérje. A legtöbb T6SS clusteren belül megtalálható a ClpV (caseolytic protease) ATP-ase, a rendszer alap komponense, amely a szekréciós rendszer motorjának tekinthető.  A rendszer további tagja az IcmF fehérjével homológ protein. Az IcmF a Gram negatív baktériumok T4SS rendszerének komponense. Más T4SS génekkel a T6SS tagoknak nincs azonossága. A V. cholerae IAHP (IcmF associated homologues proteins) clusterének területén jelen van a vas (virulence associate secretion) gén terméke (vasK), amely az IcmF fehérjével homológ. A vas gén  rendszer szekretált termékei a Hcp fehérje (28kD, haemolysin A co-regulated protein) és a VgrG (vegetalising factor related G) fehérje. A VgrG fehérje egyrésze injektálódhat az eukaryota sejtbe, ahol tropomyosin domainje révén actin filamentális változásokat okoz, de jelen lehet az extracellularis miliőben is, ahol adheziv funkciót tölthet be, több bakteriális adhezinnel, fibronectinnel rokon szerkezeti eleme révén.  Az E. coli Vgr fehérje 633 AA-t tartalmaz.  Az E. coli O9:H4-ben azonosították.

 A VI-os rendszeren szekretálódó proteinek nem tartalmaznak N terminális szignál szekvenciát, így nem a Sec rendszeren keresztül szekretálódnak a citoplazmából.

VII.  típusú szekréciós rendszer, Type VII secretion system, T7SS

A T7SS-t a humán kórokozó Mycobacteriumokban írták le. A baktériumot egy impermeábilis burok védi, amely egy belső citoplazma membránból, egy peptidoglikán rétegből, egy arabinogalaktán rétegből áll, majd ezt követi a külső membrán, amely kovalenesen kötött, szorosan összekapcsolódott hosszú láncú mycolsavból épül fel, valamint nem kovalensen kapcsolt rövidebb lipidekből, amelyek lényegesek a patogenitás szempontjából. Ezen a zárt membrán rendszeren keresztül történő transzport folyamatokhoz a baktérium többféle szekréciós rendszert használ, az általánosabb SecA1 mediált utat, egy alternatív SecA2 utat, a tat rendszert és egy speciális szekréciós utat, a VII típusú szekréciós rendszert (alternatív elnevezések: ESAT6 -early secreted antigenic target, SNN, ESX-early secretory antigenic target 6-ESAT-6 system 1 /ESX secretion apparatus/).

A T7SS rendszer létezését eredetileg bioinformatikai eszközökkel jelezték előre, bizonyos génclusterek génjeinek azonosítása alapján. Ezek olyan szekretált proteineket kódoltak, amelyekből hiányzott a szignálszekvencia és egy clusterben helyezkedtek el membrán proteinekkel, ATP-ázokkal, chaperon fehérjékkel. A M. bovis BCG vakcina törzset szekvenálva az ESX1 cluster mutációs analízisével megerősítették a rendszer szerepét a Mycobacteriumok virulenciájában. A mycobacterialis genom akár öt T7SS génclustert is tartalmaz. Ez a géncluster jelen van a rokon patogének közül a Corinebacterum diphtheriae- ben és a Nocardia-kban, de rokon génclustereket találtak más patogén és nem patogén Gram pozitiv speciesekben, amelyekben mycomembrán nem található, így pl. Streptomyces-kben, Firmicutes-kben, Clostridium-kban, S. agalactiae-ben, Listeria monocytogenes- ben, Sta. aureus- ban. A jelenlegi modell szerint a transzlokációs csatornát a belső membránban az Rv3877 integráns membránfehérje alakítja ki, a mycomembránban pedig jelenleg ismeretlen protein alkotja. Chaperon szerű ATP-ázok (Rv3871, Rv3868) kapcsolódnak a belső membrán fehérjéhez és ezek C terminális végükön effektor fehérjéket kötnek, amelyek a rendszeren keresztül heterodimerként szekretálódnak.

 A T7SS rendszer is rendkívűl komplex, multiplex komponensekből épül fel és sokféle substratja létezik. A rendszernek sok paralógja figyelhető meg, mind a mycobacteriumokban, mind a Gram pozitív baktériumokban. Az első T7SS által szekretált, megismert fehérje egy 6 kD-s struktúra volt, az ESAT6. A fehérje partner molekulája egy 10 kD-s protein (CFP10, 10 kDa culture filtrate antigen). A BCG törzsben az ESAT6 nem termelődik és többek között ez is felelős az attenuációért. Mind az ESAT6, mind a CFP10 a WXG 100 fehérjecsalád tagja, amelyek 100 aminosavból állnak, helikális felépítésűek, és jellegzetes WXG motívumot (Trp-XAA-Gly) tartalmaznak. Eddig 23 ilyen szekretált, kis molekulatömegű proteint azonosítottak. A fehérjék immunodominans T sejt antigének, génjeik esx gének (A-W). Ezek tandem páronként 11 locusban rendeződnek, 5 ilyen génlocus, az ESX 1-5, határosak a szekréciós gépezet komponenseivel. A szekréciós gépezet génjei által kódolt fehérjékre jellemző a prolin-glutaminsav (PE) és a prolin-prolin-glutaminsav (PPE) szekvencia. A szekréciós mechanizmus működéséhez a kromoszóma más területén elhelyezkedő gének által kódolt fehérjék is szükségesek pl. az rv3616c, és az rv3614c gének.

A fehérjék nomenklatúrája új, korábban ESX 1-5, rv, valamint számokkal kerültek jelölésre. A rv3871 a jelenlegi nomenklatura szerint eccCb, az rv3868 eccA, az rv3877 eccD.

A fehérjék közül az eccA  AAA+ATP-ase (ATPases Associated with diverse cellular Activities), az eccB 1 (ESX conserved components) tm (transmembrán) domainnel rendelkező transzmembrán fehérje (rv3869), eccCa,b FtsK/SpoIIIE-szerű fehérje (rokonságot mutat a filamentation temperature sensitive/chromosome seggregation proteinnel, ami DNS translocase, sejtosztódást szabályozó géncsaláddal. A család mintegy 20 fehérjéből áll, az osztódó sejt közepén kialakuló septalis gyűrűbe, az un. divisosomába rendeződnek az osztódó baktérium sejt középső részén. Az osztódó baktériumokat elválasztó szeptum kialakulásának irányítói. Mutációjuk esetében 30 CO –on normálisan szaporodik a törzs, 42 CO –on nem szaporodik és filamentosussá válik, elpusztul. Innen ered az fts elnevezés. Tarry M, Arends R, Roversi P, Piette P, Sargent F, Berks BC, Weiss DS, Lea SM. The Escherichia coli cell division protein and model Tat substrate SufI (FtsP) localizes to the septal ring and has a multicopper oxidase-like structure J Mol Biol2009, 386, 504–519), 1-3 tm-vel rendelkező transzmembrán fehérje (rv3870,3871), eccD 10-11tm domainnel rendelkező fehérje, korábban rv3877, eccE 2 tm-vel rendelkező transzmembrán fehérje (korábban rv3882c), mycP subtilisin szerű szerin proteáz (mycosin), 1 tm domainnel rendelkezik.

Az ESAT-6 és CFP-10 mellett még négy ESX1(early secretory antigenic target 6 (ESAT-6) system 1 secretion apparatus) által transzportált produktumot azonosítottak, az Esp (ESX secretion associated protein) A, B, R, és a Mycobacterium marinum homolog rv3864-t.

Külső membrán vezikulumok révén történő szekréció

A multiprotein komplexeken kívül a Gram negatív baktériumok külső membrán vezikulumok képzésével is szekretálnak különböző anyagokat. A külső membrán egy része egy gömbalakú struktúrát képezve kitüremkedik és bezár periplazmikus anyagokat. Ezekben a vezikulumokban többféle immunmoduláló virulencia faktort sikerült kimutatni. Ezek közül néhány direkt módon képes hozzátapadni, majd intoxikálni a gazdasejteket. Az ilyen vezikulum képződés különböző stressz tényezők hatására, mint általános válaszreakció, vagy szelektív speciális karboproteinek célbajuttatása céljából egyaránt kialakulhat.

Pathogenicitási szigetek

(Xu J-G, Cheng B, Wen X, Cui S, Ye C. High-Pathogenicity island of Yersinia spp. in Escherichia coli strains isolated from diarrhea patients in China. J Clin Microbiol 2000, 38, 4672–4675, Perna NT, Mayhew GF, Posfai Gy, Elliott S, Donnenberg MS, Kaper JB, Blattner FR.  Molecular evolution of a pathogenicity island from Eenterohemorrhagic Escherichia coli O157:H7. Infect Immun 1998, 66, 3810–3817, Clarke MB, Sperandio V. Events at the host-microbial interface of the gastrointestinal tract III. Cell-to-cell signaling among microbial flora, host, and pathogens: there is a whole lot of talking going on. Am J Physiol Gastrointest Liver Physiol 2005, 288, G1105–G1109, Carniel E. The Yersinia high-pathogenicity island: an iron-uptake island.Microbes and Infection, 2001, 3, 561−569).

Shi-1 vagy She: a S. flexneri 2A szerotípusában található kromoszómális lokalizációjú 46 kb méretű, a kromoszómális genom 3052464 és 3099120 bp közötti területén helyezkedik el.

A SheT1 egy enterotoxint és két autotransportert, a ShigA-t és a Pic-t kódolja. A pathogén sziget a pheV tRNS lokusz területére inzertálódott.

 

Shi2: a S. flexneri 2A tartalmazza, kromoszómális lokalizációjú, 24 kb méretű, 3806404 -3831722 bp-k között helyezkedik el a genomban. A vasfelvételt mediáló gént, az aerobactint  és a colicin 5 elleni védőrendszer elemeit kódolja. A pathogén sziget a SelC tRNS gén lokusz területére inzertálódott. Az aerobactin gének átvihető elemekre jellemző tulajdonságokkal rendelkeznek, megtalálhatók plazmidokon, így a pColV és az F1 plazmidokon az E. coli és Salmonella törzsekben.

Shi3: S. boydii patogenitási sziget, kromoszómális lokalizációjú, 21 kb méretű, 1-20962 bp között helyezkedik el a genomban. Funkcionális aerobactin operont tartalmaz. A pathogén sziget a pheU tRNS lokusz területére inzertálódott. Az Shi3 különbözik az Shi2 területén lévő aerobactin operontól. Az Shi3-ra az jellemző, hogy egy 6 kb deléció figyelhető meg benne, amelyen a cadaverinA lysin dekarboxylase enzim található. A cadaverin a lysin dekarboxilációjából keletkezik és gátolja a Shigella törzsek enterotoxicus aktivitását. Az Shi3 deléció így elősegíti a Shigella törzsek virulenciáját. Az E. coli K-12 genomjában az Shi3-val rokon terület tartalmazza a cadA lysin dekarboxylase enzimet.

Srl (Shigella resistance locus): a S. Flexneri 2A szerotípusban található PAI, kromoszómális lokalizációjú, pozíciója 1-66714 bp-ok között, mérete 66 kb. Streptomycin, ampicillin, tetracyclin rezisztencia géneket kódol, valamint egy komplett vas felvételi, ferri dicitrát rendszert. A SerX tRNS lokusz területére inzertálódott.

LEE patogenicitási sziget

A baktériumok sejtfelszínhez történő tapadását és a bélepithel sejtek felszínének  lecsupaszítást eredményező léziók (attaching and effacing laesion A/E) kialakulásában alapvető a LEE patogenicitási sziget területén kódolt fehérjék szerepe. Ez a fajta lézió mind a STEC O157, mind néhány más STEC termelő törzs típusos pathogén sajátsága, és ezek a léziók különböző típusú sejteken is megfigyelhetők. Ilyen léziók jellemzők továbbá az EPEC törzsekre is. A lézió lényege, hogy az intestinalis epithel sejtek mikrovillusai degenerálódnak és a sejtek felszíne csupasszá válik, így a baktériumok szorosan tapadnak a sejtekre és a sejten belül a cytoskeleton struktúra jellemezően átrendeződik a baktériumok tapadásának helyén. Ez a nagyfokú átszerveződést mutató cytoskeletális struktúra aktinból, tallinból ezrinből és alfa aktininből épül fel. Az enterohaemorrhagias E. coli törzsek (EHEC) közé tartoznak a STEC termelő, O157 plazmidot tartalmazó, O157 szerocsoportok, de ide tartoznak a STEC termelő O26 és O111 szerocsoportok is. Ezek valamennyien létrehoznak A/E léziókat. Az EPEC törzsek epithel sejtekhez való tapadása több szignál átviteli út aktiválásán keresztül okozz A/E léziókat, ionszekréciós változásokat és bakteriális inváziót. Az EPEC törzsekben az A/E léziók kialakulásáért felelős gének a 35,6 kb méretű, kromoszómális lokalizációjú pathogenicitási szigeten, az ún. locus of enterocyte effacement (LEE, bélsejtek felszínének lecsupaszításáért felelős génterület) helyezkednek el. A locus területén 41 open reading frame (ORF, nyitott leolvasó keret) található. Itt kódolódnak a III-as typusú szekréciós szisztéma (TTSS) fehérjéi, transzregulátorok, adhaesios struktúrák (intimin, TIR), chaperonok, szekretált, transzlokálódott proteinek. A T3SS 5 fő effektora a TIR, az Esp F, G, H és a MAP fehérjék. A LEE locuson kívül is kódolódnak TTSS effektorok, a CIF, az nlcA/EspI, a tccP/ Esp F altípus és az EspJ.

A locust mind az EPEC, mind az O157 E. coli törzsekben szekvenálták és több gén funkciójára is következtettek a szekvenciákból. Mind az O157, mind az EPEC törzsek felépítése, gén sorrendje és funkcionális szerveződése hasonló. Az EPEC törzsekben az LEE terület kissé nagyobb méretű.

A LEE területén megkülönböztethetők bizonyos régiók. A terület egyik végén a szekrécióra kerülő proteinek kódolódnak, ilyenek az EspA, B, D, (E. coli secreted protein), amelyek a jelátvitelhez és az A/E aktivitáshoz szükségesek. A lókusz másik végén található a III-as típusú szekréciós apparátus, amely szükséges  a fehérjék, így az Esp A,B, D szekréciójához. A kettő közötti, harmadik területen található az EAE, az intimint kódoló génterület. A protein egy külső membrán fehérje, amely a szoros tapadás kialakításához szükséges. Ugyanitt helyezkedik el a TIR fehérjét kódoló gén is (translocated intimin receptor), amely az epithelialis sejtekbe átkerülve az intimin receptorává válik.

A pathogenitási sziget területén kódolódó számos gén pontos funkciója még nem ismert.

Az EPEC és az O157 EHEC törzsek LEE locusának számos génje jelentős fokú homológiát (átlagosan 93%) mutat, de több különbséget is megfigyeltek. Ezek elsősorban a szekretálódott proteinek génjeiben (EspA, B, D), a TIR területeken és a sepZ (secreted protein) génrégiókban észlelhetők. Nyilvánvaló az is, hogy az A/E léziók az EPEC és az EHEC törzsekkel való fertőződés során különböző jelutakon át jönnek létre. Az EPEC törzsek LEE locusának génjei az eukaryota sejtekkel történő kontaktus után aktiválódnak. Az EspA protein csőszerű struktúrát, translocont képez, amelyen keresztül több protein, az Esp B, D és a TIR átkerül az eukaryota sejtbe. Az eukaryota sejtbe került TIR tirozin aminosavakon foszforilálódik és inzertálódik az eukaryota sejtek membránjába, ahol receptor struktúrát képez az intimin számára. A membránba inzertálódott változat aktin akkumuláció fókusz pontjává válik és szignalizációs folyamatokat elindítva a sejtben számos pathofiziológiai változást eredményez. Ezek közé tartozik a foszfolipáz C, a protein kináz C, a myosin könnyű lánc kináz aktivációja, Ca++ felszabadulása az intracellularis raktárakból és membránpotenciál változások. Az említett enzimek aktivitás változása jelentős cytoskeletális struktúraváltozáshoz, valamint különféle ionáramlások létrejöttéhez vezet, kialakítva az EPEC fertőzött sejtekre jellemző képet.

Az E. coli O157 EHEC törzs is analóg struktúrát alakít ki. Azonban E. coli O157 EHEC törzsekkel való fertőzés során az A/E léziói lassabban alakulnak ki, mint az EPEC  fertőzés esetén, és a TIR tirozin foszforilációs mintázata is különbözik. Az EHEC törzsekben a TIR 474 pozíciójú tirozinja szerinre substituálódott. A TIR szekrécióban megmutatkozó különbségek magyarázhatják az O157 törzsek csökkent invazivitását, a sepZ gén különbségei pedig hozzájárulnak az EPEC és O157 EHEC törzsek TIR szekréciós különbségeihez. A sepZ fehérje 98-100 aminósavból áll, az eukaryota sejtbe kerülve modulálja a III-as típusú szekréciós rendszer, így a TIR működését.

A két enterális kórokozó E. coli törzs fehérjéi között megfigyelhető homológia csak 71%-os. Az intimineknek antigenetikus sajátságaik és DNS szekvenciájuk alapján több típusa is létezik.

Az O126 és O111 STEC törzsek intiminjeinek homológiája igen nagyfokú, de az O157-vel összehasonlítva kisebb, csak kb. 60%-os. Hasonlóan, a különböző STEC szerocsoportok között is jelentős különbségek vannak a TIR molekulák aminosav sorrendjében és antigenitásában. Az intimin és TIR molekulák szekvencia különbségei magyarázzák a különböző STEC törzsek adhezív sajátságainak és betegséget okozó képességének különbözőségeit.

A LEE locus működésének szabályozása is befolyásolja a STEC törzsek virulenciáját.

Az LEE régió 5 fő operonja a következő: LEE 1, 2, 3, 4 (TTSS), 5 (TIR).

Az LEE gének szabályozása komplex, LEE kódolt és nem LEE kódolt regulátorok is részt vesznek benne. Az általános non LEE kódolt regulator a H-NS (histone-like nucleoid-structuring protein) transzkripciós faktor(hiszton szerű fehérje, a hns gén kódolja, homodimer, 136 AA), amely represszorként működik, és az IHF (integration host factor), amely aktivátor.

A quorum sensing (QS) rendszer a baktériumok sejt-sejt interakciót közvetítő, signalizációs rendszereket érzékelő apparátusa, amely számos hormonális vagy egyéb molekulát képes felismerni és erre génexpresszió változással reagálni. A mechanizmus alapvető a virulencia gének szabályozásában az enterális coli fertőzések során, pl. az O157 EHEC HUS fertőzések esetén is. A quorum sensing rendszer szabályozza az LEE gének, az STX1, 2, a flagella regulon (flhDC, master motility operon, az FlhD és FlhC proteinek a class II flagellaris promoter /FlhD2C2/ heterotetramer transcriptionalis activatorai, az FlhD az FlhC nélkül a sejtosztódás represszora) és több más gén expresszióját.

A QS rendszer alapvető eleme a LuxS (luminescence expression) gén és terméke, amely az s-adenosyl-methionin metabolismusában vesz részt. A ribose-homociszteint konvertálja homociszteinné és 4,5-dihidro-2,3-pentanedionná.  A QS regulátor rendszer képes felismerni az intestinalis környezetet és aktiválni azokat a géneket, amelyek a kolonizációhoz szükségesek. Az autoinducer molekulák, amelyek révén az EHEC törzsek érzékelik a vastagbél környezetet (autoinducer AI3) epinephrin és norepinephrin analógok, amelyek bekapcsolják a patomechanizmusban alapvető géneket.

A LEE gének LEE locus területén található regulátorai közé tartozik a Ler (LEE encoded regulator) és a GrlA (global regulator of LEE activator). A Ler szükséges a GrlA aktivációjához és a két regulátor kölcsönösen indukálja egymás expresszióját, gátolva a H-NS által közvetített repressziót.

 Az EPEC törzsekben az LEE gének regulációját egy plazmidon elhelyezkedő lókusz, a PerA-C (plasmid encoded regulator) is szabályozza, amely aktiválja a Ler transzkripcióját. Ez azután elindítja más LEE gének, így az EspA, B és D szekretált proteinek transzkripcióját. Az EHEC törzsekben nincs jelen perA-C locus, itt a LEE gének aktivációja a Ler révén történik. Az EPEC törzsekben a LEE lókusz aktivációja a vékonybél sejtjeihez történő adhézió révén indul el, az O157 EHEC törzsekben pedig a vastagbél epithelialis sejtjeihez történő adhézió indítja el a lókusz aktiválódását.  Az intimin (eae) minden bizonnyal valamennyi STEC O157 izolátumban expresszálódik. A non-O157 STEC törzsek csökkent virulenciája összefüggésben állhat az intimin expresszió hiányával.

Emberi O157 és nem O157 STEC törzseket vizsgálva azt találták, hogy valamennyi O157 és közel 90% nem O157 törzs hordozta az eae gént. Állati, nem O157 izolátumokban azonban a génterület csak kevesebb, mint 50%-ban volt jelen. Egészséges állatokból származó STEC törzsek mindössze 1-4 %-a tartalmazta az eae gént. Emberi fertőzésekből izolált bovin STEC törzsekben azonban 92%-ban figyeltek meg eae gént. Általában azt tartják, hogy az emberi megbetegedésekből izolált non O157 STEC törzsek gyakran hordozzák az eae gént, az állati non O157 STEC izolátumok pedig ritkábban. Az EPEC, az ETEC és az EHEC törzsek azonban más adhéziós struktúrákat is tartalmaznak. A STEC O157 törzsekben jelen vanak a pO157 plazmidon kódolt fimbriális adhaesinek, amelyekkel a baktériumok különféle sejtekhez, így pl. a Henle 407 (embryonális intestinalis epithelial sejtvonal), és HEp 2 sejtekhez képes tapadni. Az EAggEC és EPEC törzsek nagy plazmidjainak AAFI és bfp clusterei is tartalmaznak fimbriális géneket. A pO157 60 MD plazmid variáns azonban nem tartalmaz fimbriális génstruktúrákat. Egyes fimbriális gének lehetnek kromoszómálisan kódoltak is. Az O157 izolátumok egyes külsö membrán proteinjei szintén elősegítik a törzsek bizonyos epithelialis sejtekhez (Henle 407, HeLa) történő adherenciáját. Az adherenciában közreműködő Iha gén (Irg homolog adhesin génje) homológ a V. cholerae IrgA (Iron regulated protein) génjével és minden O157 izolátumban jelen volt, valamint 80%-ban megtalálták az eae pozitív non O157 emberi izolátumokban is. Az E. coli O157 EHEC törzsekben leírtak ún. „log jam pattern” (torlódási mintázat) mintázatot, amely a baktériumok adherenciáját és felhalmozódását mutatta a sejtjunkcióknál ileo-coecalis sejtkultúrákban (HCT-8). Ez a mintázat nem kizárólag a STEC O157 sejtekre volt jellemző, előfordult más pathogén coli törzsek esetében is. Úgy gondolják, hogy a log jam az intestinalis kolonizáció alap adherencia mechanizmusa lehet.  O111:H2 szerotípusú HUS kitörésből izolált törzsek a STEC törzseknél korábban nem észlelt aggregatív adherencia mintázatot mutattak. Specifikus PCR primerekkel EAggEC génszakaszok voltak kimutathatók a törzsekben (eae és pO157 negatív subtípusok voltak). Úgy gondolják, hogy az aggregatív adherencia képesség ugyanúgy lehetővé teszi a bélrendszer kolonizációját, mint az eae pozitivitás. Néhány megfigyelés arra utal, hogy a lipopoliszacharid (LPS) indirekt módon hatást gyakorolhat az adhesivitásra. LPS elleni antitestek gátolták az O157 STEC törzsek adherenciáját Henle 407 sejtekhez. Az LPS deficiens mutánsok hiperadherenciát mutatnak HEp 2 sejtekhez. Valószínű, hogy az LPS struktúra elfedhet bizonyos adhezív molekulákat a baktériumok felszínén, esetleg fiziko-kémiai hatások, töltés, vagy hidrofobicitás révén csökkentheti az adherenciát. Még jelenleg is tisztázatlan számos részlet az O157 és nem O157 STEC törzsek adhéziós mechanizmusait illetően.

Toxinok

(Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, Hebert RJ, Olcott ES, Johnson LM, Hargrett NT, Blake PA, Cohen ML.Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med 1983, 308:681–685, KarmaliM, SteeleBt, PetricM, LimC.Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet1983,i: 619-620, Eidels IL, Proia RL, Hart DA. Membrane receptors for bacterial toxins Microbiol Rev 1983, 47, 596-620, Qadri F, Svennerholm A-M, Faruque ASQ, Sack RB. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin Microbiol Rev 2005, 18,465–483, Proulx F, Seidman EG, Karpman D. Pathogenesis of Shiga toxin–associated hemolytic uremic syndrome.Pediatr Res, 2001, 50, 163–171,Sandvig K, van Deurs B. Transport of protein toxins into cells: pathways used by ricin, cholera toxin and Shiga toxin. FEBBS Lett 2002, 529, 49-53, Sandvig K, van Deurs B. Entry of ricin and Shiga toxin into cells. Molecular mechanisms and medical perspectives. EMBO J 2000, 19, 5943-5950, Bielaszewska M, Köck R, Friedrich AW, von Eiff C, Zimmerhackl LB, Karch H, Mellmann A. Shiga toxin-mediated hemolytic uremic syndrome: time to change the diagnostic paradigm? PLoS ONE 2007, 2 (10), e1024, Hussein HS. Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J Animal Sci 2007, 85, E63-72, Lord JM, Roberts LM. Retrograde transport: Going against the flow. Current Biology1998, 8: R56–R58, Wassmer T, Attar N, Harterink M, van Weering JRT, Traer CJ, Oakley J, Goud B, Stephens DJ, Varkade P, Korswagen H, Cullen PJ. The retromer coat complex coordinates endosomal sorting and dynein-mediated transport, with carrier recognition by the trans-Golgi network. Developmental Cell, 2009, 17, 110–122).

A legjobban karakterizált virulencia faktorok, általában a tenyészetek felülúszójából kerülnek tisztításra és elemzésre. Ezekből készülnek toxoid vakcinák, illetve különböző adjuvánsok. A gazdasejteket különféle mechanizmussal károsítják, gyakran enzimatikus folyamatok során. Az exotoxinok leggyakrabban proteinek és a baktériumok a folyékony táptalajokban szekretálják őket. Az endotoxin nem fehérje természetű lipopolisacharid (LPS), amely alapvetően szénhidrátokból épül fel. Enzimatikus aktivitása nincs és általában nem szekretálódik. Az LPS alapvető komponense a Gram negatív baktériumok szerkezetének. Általános értelemben nem tekinthető bakteriális virulencia faktornak. A gazdaszervezetben azonban aktiválja az immunrendszert, a cytokinek termelődését, elsősorban a membrán Toll-like receptor 4-hez (TLR 4) (és a citoplazmikus NOD2 struktúrákhoz) történő kapcsolódás révén (Fiziológiai és orvosi Nobel díj 2011, Dr. Bruce A Beutler,How Mammals Sense Infection: From Endotoxin to the Toll-like Receptors. Nobel Lecture by Bruce A. Beutler, 2011 www.nobelprize.org)

  

Bruce Beutler

A kép forrása: Internet

A kapcsolódás komplex és többféle mechanizmussal történhet. Létrejöhet az LPS kötő fehérje, a CD14, az MD2 (Ly96, Myeloid-differentiation protein-2, sejtfelszíni LPS-vel, LPS kötő proteinekkel, TLR 4-vel és TLR 2-vel, CD 14-vel kapcsolatban lévő fehérje, homodimer, szekretált változata is ismert. 8q21.11, 37736 bp, 160 AA, 18546 Da, 13 fehérje kapcsolat, 518 SNP, www.genecards.org) és a TLR 4 együttes interakciójával, de ettől eltérő útakon is. A TLR 4 mellett a szervezetben számos LPS-vel kapcsolódni képes molekula található.

A bakteriális LPS-t felismerő emlős gazdasejt receptor a TLR 4, a flagellint felismerő receptor a TLR 5 (Toll-like receptor 5, bakteriális flagellint felismerő fehérje, aktiválja az NFkB-t. 1q41-q42, 33877 bp, 858 AA, 97834 Da, 8 fehérje kapcsolat 610 SNP, www.genecards.org), a kétszálú nem metilált DNS szigetek nukleotidjait a TLR 9 (nem metilált CpG dinukleotidokat tartalmazó bakteriális DNS-t felismerő receptor. 2p21.2, 5084 bp, 1032 AA, 115860 Da, 25 fehérje kapcsolat, 147 SNP, www.genecards.org) ismeri fel. A többi TLR receptor aktivációja (1, 2, 3, 6, 7, 8, 10) és interaktív szabályozó szerepe hozzájárul mind a veleszületett, mind a szerzett immunapparátus aktivációjához. A sejtfelszíni és endosomális elhelyezkedésű TLR receptorok mellett közel egyidejűen a pathogén kórokozók egyes struktúráinak felismerése intracellulárisan is létrejön, például a NOD 1, 2, (nuclear oligomerization domain) fehérjéken keresztül. A NOD fehérjék citoszolban található pathogén asszociált mintázatokat felismerő fehérjék, caspase toborzó domaint, nukleotid kötő egységet, és 10 tandem leucin gazdag ismétlődést tartalmaznak. A NOD 1 homodimer, a Gram pozitív baktériumok sejtfalának peptidoglikán muropeptidjeit érzékeli. Hatására aktiválódik az NFkB rendszer. NOD 1: 7p15-p14, 54258 bp, 953 AA, 107691 Da, 31 fehérje kapcsolat, 736 SNP (www.genecards.org).

Az immunrendszer megfelelő működéséhez valamennyi felismerő rendszer negfelelően koordinált működése szükséges.

Ennek hiányában krónikus inflammatorikus/autoinflammatorikus betegségek alakulhatnak ki.

Jelenleg nem ismert, hogy miként következik be a baktériumokból a Shiga toxin felszabadulása, és pontosan hogyan jön létre bizonyos betegekben a HUS kialakulása. Nem ismert az sem, hogy mi a magyarázata a németországi járvány során megfigyelt női dominanciának. 

Az összefoglaló szerzőinek feltételezése a következő.

A baktériumok okozta enterocolitis lefolyása során a veleszületett és a szerzett immunapparátus a kórokozók pusztulását okozza. Ez a folyamat vezethet a pusztuló baktériumokból a shiga toxin kiszabadulási mechanizmusainak aktiválódásához. Ez kezdetben a veleszületett immunrendszer, defensinek, citokinek, komplement rendszer aktivációja, makrofágok, granulocyták, NK (naturális killer) sejtek, majd az adaptív immunválasz hatására a baktériumokban bekövetkező stress válasz következtében jöhet létre.

Felvethető, hogy egyes LPS O, illetve H szerotípusok nagyobb mértékű TLR aktivációs képességgel rendelkeznek.

Az intracelluláris bakteriális mintázat felismerő struktúrák, a NOD 2 (nuclear oligomerization domain) fehérjék részvétele az E. coli kiváltotta pathogenetikai folyamatokban, a HUS kialakulásában szintén  valószínűsíthető. Feltételezhető az is, hogy az egyes szerotípusok NOD fehérjéket aktíváló képessége is eltérő. Az említett immunológiai felismerő rendszerek szerepelhetnek a HUS pathomechanizmusában is. A TLR és NOD struktúrák aktivációjára bekövetkező citokin és chemokin produkció, együttesen a növekvő STX expresszióval fokozzhatja a vese glomerulusok vaszkuláris endotél sejtjeinek Shiga toxin receptor (GB3, stx2e esetén GB4) expresszióját. A Shiga toxin kötődése a receptorához tovább fokozhatja a vesében egyes cytokinek, a TNF alfa, TNF beta (LTA, lymphotoxin alpha, TNFSF1, a TNF család ligand tagja, szekretált és membrán kötött formája egyaránt előfordul, heterotrimer, a lymphocyták által termelt citokin. Részt vesz az immunrednszer szabályozásában, az inflammatorikus válaszban, az apoptozis regulációban és antivirális hatású. 6p21.3, 2271 bp, 205 AA, 22 297 Da, 12 fehérje kapcsolat, 77 SNP), IL6 (multifunkcionális citokin, részt vesz az immunreguláció szabályozásában, B sejtek maturációjában, a gyulladásos folyamatokban, az acut fázis reakció szabályozásában. 7p21, 6119 bp, 212 AA, 23718 Da, 47 fehérje kapcsolat, 170 SNP, www.genecards.org), IL1beta termelődését, ami egyre erődöső circulus vitiosusként végül esetenként előidézheti a HUS kialakulását.

Általában az ösztrogén receptorok aktivitása csökkenti, az androgén receptoroké pedig fokozza egyes citokinek, chemokinek termelődését irányító transzkripciós faktorok aktivitását (NFkappaB, jun/fos /AP1 activator protein 1/, STAT /signal transduction and activation of transcription/). A nukleáris hormon receptorok szabályozó működésében meglévő eseti különbség (polimorfizmusok, élettani ciklicitás, nem ismert környezeti hatások együttese) állhatnak a nemek tekintetében megfigyelt HUS előfordulási különbség hátterében.

Az exotoxinok különböző típusúak és specifitásúak lehetnek. Általánosan két alapfunkciójuk van, amelyek gyakran különválnak egymástól. Az egyik a gazdasejt receptorához való kötődés képessége, a másik az enzimatikus aktivitás. Sok toxin (cholera toxin, labilis toxin, Shiga toxin) 5 kötő B alegységgel (B binding) rendelkezik és kapcsolódik az enzimatikus aktivitással rendelkező A alegységhez. Kifejlesztettek vakcinát néhány toxin B alegységének felhasználásával, a katalítikus alegységek jelenléte nélkül. Így nem kell toxikus hatással számolni az immunizálás során.

Más toxinok, mint pl. a streptolysin O, staphylococcus alfa toxin, E. coli haemolysin képesek insertálodni a gazdasejt membránjába és oligomerekké felépülve pórust képeznek és a gazdasejt lízisét okozhatják.

A haemolysinek szekréciója az I-es typusú szekréciós rendszerrel történik.

Endotoxin

O antigénből, core poliszacharidból és lipid A- ból felépülő lipopoliszaccharid, funkcionális szempontból hozzájárul a gazda védekezőrendszerével szembeni rezisztenciához és az intracelluláris terjedéshez, de a baktérium inváziójában nem kóroki szerepű.

Exotoxinok

Általánosságban bakteriális exotoxinok szekretált protein molekulák, amelyeket többféle módon csoportosítanak. Az egyik szokásos csoportosítás a következő.

1-es típusú toxinok: sejtfelszíni aktivitást mutatnak, különöböző típusaik a

- szuperantigének: S. aureus, S. pyogenes fertőzések során a toxikus shock szindróma (TSS)  előidézésében szerepelnek. Az MHC II és TCR V béta láncának összekapcsolásával nagyfokú, mintegy 20%-os nem specifikus, polyclonális T sejt aktivációt okoznak.

- hőstabil enterotoxinok: kis molekula tömegű peptidek, amelyek 100 oC-os hőmérsékletnek is ellenállnak, többféle receptor családot ismerhetnek fel. Ezek közé tartozik E. coli STa, amely aktiválja a membránhoz kötött guanilát cyclázt és intracellulárisan cGMP emelkedést okoz.

 2-es típusú toxinok: membránkárosító toxinok, haemolizinek vagy cytolysinek. Alapvető szerepük az infekciókban nem elsősorban a sejtlízis indukciója, hanem az, hogy már alacsony koncentrációban is modulálják a sejtek jelátvivő folyamatait.

toxinok.

Két altípusuk a csatornaképző és az enzimatikus aktivitással rendelkező

A csatornaképző toxinok a membránban pórusokat képeznek.

Két további altípusuk ismert.

A cholesterin dependens cytolysinek (CDC) a célsejtek membránjában nagyméretű 25-30 nm-es lyukakat ütnek, ilyen pl. C. perfingens- perfringolysin O.

Valamennyi családtag esetében a C terminális végen 11 aminosavból álló konszenzus szekvencia található (EATGLAWDPWW). A II-es típusú szekréciós rendszer segítségével szekretálódnak.

További családtagok a S. pneumoniae pneumolysin, L. monocytogenes listeriolysin. Ez utóbbi a célsejtek magjában a hisztonokat modifikálva csökkenti a gyulladásos válasz génjeinek expresszióját.

Az ide tartozó másik toxin család az RTX (repeats in toxin) toxinok, amelyek 9 aminosavból álló tandem ismétlődéseket tartalmaznak.

Az enterohaemolysinek (EHX)

Mosott erythrocytákat tartalmazó véres agarban 18-24 órán belül kis, zavaros, haemolyticus zóna keletkezik az enterohaemolysint termelő coli törzsek körül. Az alfa haemolysin termelő coli törzsek ezzel szemben nagy, áttetsző haemolyticus zónát produkálnak, gyakran már négy órán belül, mosott és nem mosott vvt-ket tartalmazó véres agarban is. Az alfa haemolysin az emberi lymphocyták ellen is haemolyticus aktivitású. Az EHX és az alfa haemolysin között kb 60%-os a rokonság. Az enterohaemolysinek a RTX toxin családba tartoznak, amelyeket sok patogén baktérium termel.

Vonatkozó gének: hlyA, B, C, D (haemolysin), membránkárosító, pórusformáló RTX típusú toxint kódolnak, amely az I. típusú szekreciós rendszer révén szekretálódik. Az említett gének egy operon részei. A haemolysin struktúrális génje a hly. Az operon által kódolt export rendszer, az I. típusú szekréciós szisztéma része, a hlyB és D.

Az RTX toxinok (repeat in toxin) neve 9 aminosavból álló ismétlődésből ered, amely glicin gazdag 9 aminósav XXGGXGXDX tandem duplikációjából származik és calcium kötésére képes. Ez az aminósav terület a toxin család valamennyi tagjának a C terminális részén jelen van. A hlyA hatásához szükséges acylációt a hlyC toxin modifikáló enzim végzi el. A hly operon az EHEC O157: H7 törzsekben plasmidon kódolt, az UPEC törzsekben pedig kromoszómálisan elhelyezkedő patogenitási sziget területén helyezkedik el, a P fimbriális gének közelében. A ProhlyA fehérje a baktérium citoplazmájában aktiválódik a hlyC zsírsav acyl transferase hatására, és haemolyicusan aktivvá válik. A peptid C terminális része (Trp 944-Arg 956) a fő receptor kötő régió. A szekrécióhoz szükséges export rendszer belső membrán proteinjei a hlyB, D, külső membrán proteinje pedig a multifunkcionális TolC (részletek a szekréciós rendszereknél). A hlyB 8 hidrofób alfa helikális transzmembrán domainjével inzertálódik a belső membránba. A hlyD egy membrán fúziós protein, a citoplazma membránhoz egyszeres transzmembrán domainnel horgonyzódik, periplazmikus nagy domainje 100 aminósavból áll. A hlyA citotoxicus hatású az erythrocytákra, granulocytákra, monocytákra, endothel sejtekre, renális epithel sejtekre, és stimulálja az IL-1béta és a TNF-alfa felszabadulását. A toxin a vörösvérsejtek felszínén glycophorinhoz, a leukocytákon béta 2 integrinekhez kötődik, majd ezt követően inzertálódik a sejtmembránba. A toxin glicin gazdag ismétlődéséhez kötődő calcium alapvető fontosságú a toxin aktivitásának kialakulásához.

Ilyen szerkezetű toxin az E. coli HlyA mellett a L. pneumophila RTX toxinja is.

A 3-as típusú, intracellularis toxinok felosztása a sejtbe való bejutásuk alapján történik. Ez történhet a már részletezett III-as típusú szekréciós mechanizmussal, amely injekciós tűként a baktériumból a gazdasejt citoplazmájába injektála a toxint.

A másik behatolási mechanizmus az AB toxinok csoportjára jellemző (STX, cholera, pertussis toxinok).

Az intracellularisan ható toxinok hatásmechanizmusa lehet riboszóma gátlás, elongációs factor 2 gátlás, illetve adenyl-cyclase aktivitás fokozódás.

Hőlabilis toxin (LT heat labile toxin): intracellularisan ható A-B típusú, ADP-ribozil transferáz aktivitású protein. Az ETEC törzsek toxinja. Vonatkozó gének: eltA, eltB.

II-s típusú szekréciós rendszeren keresztül szekretálódnak az extracellularis térbe. Az LT1 plazmidon kódolt. Az LT2 állatokban fordul elő. A két altípus antigenetikusan különböző. Struktúrálisan és funkcionálisan hasonlóak a cholera enterotoxinhoz. Az LT1 A és B alegységekből áll, a B alegység a gazdasejt membránján a GM1 gangliozidhoz kötődik. Az A alegység A1 és A2 proteolitikusan elválasztódó alegységekből áll, amelyeket diszulfidkötés kapcsol össze. Az A1 peptid enzimatikusan aktív, ADP ribozil transferáz aktivitású. Az LT2 toxinnak két antigén variánsa különböztethető meg, az LT2A és B. Az A alegység az LT2 toxinban is azonos funkciójú, mint az LT1-ben.  Az LT2A B alegysége a GD1B gangliozidhoz, az LT-2B toxin esetében a GD1A gangliozidhoz kötődik. Funkcionális szempontból ADP ribozilációt és adenylcikláz aktivációt okoznak, amely ionszekréciót eredményez és szerepet játszik a hasmenés kialakuláslában.

A toxin hatásmechanizmusa a következő: a toxin transferálja a NAD-ról az ADP ribózt a stimulátoros GTP alfa alegységének 201. pozíciójú argininjére, blokkolva ezzel az alegység GTP-ase aktivitását. Ennek következtében az adenyl-cyclase permanensen aktív állapotba kerül, ami megemelkedett intracellularis cAMP koncentrációt eredményez. Az emelkedett cAMP szint a cAMP dependens protein kináz, a PKA (protein kináz A) aktiválódását okozza. A PKA foszforilálja az intestinalis epithelsejtek apicalis membránjának ioncsatornáit. Itt az elsődleges célpont a CFTR (cistic fibrosis transmembran conductance regulator) csatorna. A csatorna aktiválódása fokozott  Cl- szekrécióhoz vezet az intestinalis crypták sejtjeiből és csökken a Na+ és a Cl- absorpciója a bélsejtek villusain.

Hőstabil toxin (ST heat stable toxin): Az ETEC törzsek toxinja. Vonatkozó gén sta. Membránon ható guanylát cyclase aktiváló toxin. Egy peptidből álló, kisméretű toxin. Két, egymással nem rokon osztálya létezik, az STa és STb. A két toxin alosztály egymástól struktúrálisan és funkcionálisan is különbözik. Emberi betegséggel csak az STa kapcsolatos, az STb állati betegségek patomechanizmusában szerepel.

Az STa toxin 18 vagy 19 aminosavból álló, 2 kD méretű peptid, 6 cystein aminosav és 3 intramolekuláris diszulfid híd található benne. A három diszulfid kötés alapvető a hőstabilitás és a biológiai aktivitás szempontjából. Az STb toxin 48 aminósavat és két diszulfid kötést tartalmaz. Az STa a membrán guanylát cyclase-t aktiválja, ami következményesen ionszekréció növekedést okoz. Az STb az intracellularis Ca++ szintet növeli, ami szintén az ion szekréciót fokozza.

A toxinok hatásmechanizmusa a következő: az STa a guanylát cyclase C extracellularis ligand domainjével kapcsolódik az intestinalis epithel sejtek kefeszegélyének membránjában, amely a guanylát cyclase aktivitásának növekedéséhez vezet. Ez növeli az intracellularis cGMP szintet. Ennek következtében a sejtek villosus csúcsán gátlódik a Na+ és Cl- felszívódás, az intestinalis crypták sejteiben pedig stimulálódik a Cl- szekréció. A folyamatokban szerepet játszanak a cGMP és cAMP dependens kinázok is.

Az STb intestinalis receptorát még nem azonosították. Az STb kapcsolódása a bélsejtekhez szerotonin felszabadulást, PGE2 termelést és megnövekedett citoszol Ca++ koncentrációt okoz.

EAST1: enteroaggredative heat stable toxin 1, EAEC hőstabil enterotoxin 1. Membránon ható guanylát cyclase stimuláló toxin. A guanylát cyclase aktiváció ionszekréciót eredményez, ami a diarrhoe patomechanizmusában alapvető. 38 aminósavból álló, 4 cystein reziduumot tartalmazó peptid, homológ az ETEC Sta toxinjával. A toxint az EAEC törzsek mellett termelik az EHEC, ETEC és EPEC törzsek is.

Kódoló génje az astA (EAST1 toxin gene)

Pet: plazmid encoded enterotoxin. Intracellularisan ható szerin proteáz, toxin és autotranszporter. A nagy virulencia plazmidon kódolódik, az AAF gén szomszédságában. A SPATE család tagja. A SPATE szerin proteáz autotranszporterek az Enterobacteriaceae által termelt toxicus hatású, enzim aktivitású fehérjék. Ezek közé tartozik a Pet mellett az EAEC és a S. flexneri törzsek által termel Pic, az EPEC törzsek által termelt EspC, az EHEC törzsek által termelt EspP, az UPEC törzsek által termelt Sat, az APEC törzsek által termelt Tsh, és a S. flexneri által termelt SepA. A SPATE proteázok több szubsztrátot hasítanak, így a mucint, a pepsint, a spectrint, és az emberi V. alvadási faktort.

A Pet a citoszkeletális spektrint (a spectrin aktin keresztkötő fehérje, amely az aktin citoszkeletont a plazma membránhoz kapcsolja. Szabályozza a transzmembrán proteinek elrendeződését és a sejt alakját. Alpha és béta dimerekből felépülő tetramer. A fehérje alegység 22 spektrin ismétlődést tartalmaz, amelyek a dimer képzésben vesznek részt. 1q21, 76229 bp, 2419 AA, 280014 Da, 43 fehérje kapcsolat, 1178 SNP, www.genecards.org) hasítja, ami morfológiailag az epithelialis sejtek lekerekedését eredményezi.  Kódoló génje a pet.

Pic: protein involved in intestinal colonization. Az előzőhöz hasonló szerin proteáz, toxin és autotranszporter. Mucináz aktivitású. A mucinok O-glikozilált fehérjék, amik az epithelialis felszínek mucosus védő rétegét alakítják ki. Szerepet játszanak az intracellularis szignalizációs folyamatokban. A nyálkahártya felszíneken az epithelialis sejtek apicalis felszínén expresszálódnak, számos szövetben (tüdő, emlő, gyomor, pancreas). A proteinek alpha és béta alegységekre hasadnak, és heterodimer komplexet képeznek. Az alpha alegység N terminális rézse sejtadhezióban, a béta alegység C terminális része a szignalizációban vesz részt. A fokozott expresszió, aberráns lokalizáció és a glikozilációs változások a karcinoma sejtekre jellemzőek. Muc gének: Muc 1-22, Muc B1, Muc L1, Muc 3A, B, Muc5AC, Muc5B. Muc1, 1q21, 4408 bp, 1255 AA, 122102 Da, 10 fehérje izoform, 30 fehérje kapcsolat, 88 SNP (www.genecards.org).

A Pic és a Set 1 ugyanazon kromoszómális locus területén kódolódik, az ellentétes irányú szálakon. Kódoló génje a pic (részletezve az V. típusú szekréciós rendszer részben).

A S. flexneri 2a -ban két enterotoxint figyeltek meg, az enterotoxin 1-t (ShET-1), és az enterotoxin 2-t (ShET-2).

ShET1 (ShET: Shigella enterotoxin 1): A legtöbb S. flexneri 2a törzs termeli, de a toxin az EAEC törzsek virulencia faktora is. AB típusú, kromoszómálisan kódolt, 55kD-os toxin. 20 kD méretű katalitikus A alegységből, amelyet a set1 (Shigella enterotoxin 1  gene) gén A lokusza kódol, és öt, egyenként 7 kD méretű B alegységből, amelyet a setB gén kódol, épül fel. Funkcionális szempontból a toxin ionszekréció fokozódást eredményez, nem tisztázott mechanizmus révén. Kódoló gének set1A és set1B. A shigellozis korai hasmenéses fázisáért felelős.

ShET2 (Shigella enterotoxin 2, ShET 2-2): 140 KD inváziót elősegítő (inv invasion) plazmidon (pSB4_227) a sen gén (Shigella enterotoxin gene, 64746-65885 bp között a negatív szálon) által kódolt toxin. A T3SS rendszeren szekretálódik. A toxin átíródása a T3SS rendszer fehérjéinek átíródásával szinkronizált. EIEC (75%) és Shigella törzsek (82%) termelik. A toxin hasonlóságot mutat az E. coli hőlabilis, cholera toxinszerű enterotoxinjának B alegység oligomerjével (80 %-os szekvencia homológia).  Hatásmechanizmusa nem ismert. Szintén a shigellozis korai hasmenéses fázisában szerepel.

A  németországi járvány során a szövődmények kialakulásában nagy szerepet játszott a Shiga szerű toxin (stx).

Az stx-ről általában

Az E. coli bizonyos törzsei által termelt exotoxin a Shiga szerű toxin (Shiga-like toxin vagy verotoxin, stx). A verotoxin név onnan származik, hogy az afrikai zöld majmok vesesejt kultúrájára, a Vero sejtekre toxicus hatást gyakorolt. Shiga like toxinnak pedig az alapján nevezik, hogy nagyfokú hasonlóságot mutat a Shigella dysenteriae által termelt AB5-típusú Shiga toxinnal. A különbség mindössze egy aminosav. A Shiga toxinok a riboszóma inaktiváló proteinek (RIP) nagyobb fehérje családjába tartoznak. Ezek között találhatók növényi eredetű toxinok (pl. ricin és abrin) is. Közös tulajdonságuk, hogy irreverzibilisen inaktiválják a riboszómákat a nagy riboszómális alegység specifikus adeninjének eltávolítása révén. 

A toxin története

Kiyoshi Shiga 1898-ben írta le a Shigella dysenteriae 1-es típust (Shiga K. Über den Dysenterie-Bazillus (Bacillus dysenteriae). Zentralbl Bakteriol Orig 1898, 24, 913-918).

 

Kiyoshi Shiga Albert Ludwig      Sigesmund Neisser

 1871-1955                                  1855-1916

A képek forrása: Internet

Conradi ismerte fel 5 évvel később, hogy a Shiga bacillus kivonata megbénítja és elpusztítja a nyulakat (Conradi H. Über losliche, durch asptische Autolyse erhaltene giftstoffe von Ruhr- und Typhus-Bazillen. Dtsch Med Wochenschr. 1903, 29, 26-28).  Hasonló megfigyelést tett Neisser és Shiga is ugyanebben az időben, függetlenül Conraditól  (Neisser A, Shiga K. Über freie Rezeptoren von Typhus- und Dysenterie Bazillen und über das Dysenterie Toxin. Dtsch Med Wochenschr 1903, 29, 61-62).

Felismerték, hogy a magas Fe koncentráció gátolja a Shiga toxin szintézist és azt, hogy a toxin célpontja a vascularis endothelium, és letális hatású bizonyos epithelialis sejttípusokra.

A legdöntőbb bizonyíték az STX szerepéről annak kimutatása volt, hogy az STX és rokon toxinok HUS-t okoznak (Keusch GT, Grady GF, Takeuchi A, Sprinz H. The pathogenesis of Shigella diarrhoea. II. Enterotoxin induced acute enteritis in the rabbit ileum. J Infect Dis 1972, 126, 92–95).

A Shiga toxint 1977-ben egy ottawai laboratóriumban találták meg  Konowalchuk és mtsai(Konowalchuk  J, Speirs JI, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immun 1977, 18, 775–779). Leírták, hogy egyes diarrhoegén E. coli törzsek citotoxinja in vitro képes elpusztítani a Vero sejteket (vese epithel sejtvonal, 1962-ben Yasuamura és Kawakita fejlesztette ki, az elnevezés eszperanto, Verda Reno- zöld vese), ahonnan a coli toxin alternatív elnevezése ered.

Shiga szerű toxint termelő törzsek jelenlétét háziállatokban 1993-ban írták le Beutin és mtsai (Beutin  L, Geier D, Steinruck H, Zimmermann S, Scheutz F. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J Clin Microbiol 1993, 31, 2483–2488).

Lothar Beutin

A kép forrása: Internet

a toxint több munkacsoport tisztította. A toxin izolálása után lehetővé vált monospecifikus citotoxin neutralizáló antitest termelése nyúlban, amelynek alkalmazásával O’ Brien és mtsai 1977-ben azonosítani tudták a toxint termelő E. coli törzseket (O’Brien AD, LaVeck GD, Griffin DE, Thompson MR. Characterization of Shigella dysenteriae 1 (Shiga) toxin purified by anti-Shiga toxin affinity chromatography. Infect Immun 1980, 30, 170–179).

1983-ban írta le O’ Brien az O157:H7 E. coli törzsek STX verotoxin termelését, az USA-ban (és Kanadában Johnson és mtsai)  kitört haemorrhagias colitis járvány kapcsán, és azonosították a toxint a korábban leírt verotoxinnal (O’Brien  AD, Lively TA, Chen ME, Rothman SV, Formal SB. Escherichia coli O157:H7 strains associated with haemorrhagic colitis in the United States produce a Shigella dysenteriae 1 (Shiga) like cytotoxin. Lancet  1983, i:702, Johnson W M, Lior H, Bezanson GS. Cytotoxic Escherichia coli O157:H7 associated with haemorrhagic colitis in Canada. Lancet 1983, i:76 letter).

Karmali és mtsai ebben az évben (1983) vetették fel, hogy a verotoxint termelő organizusok felelősek a HUS kialakulásáért (KarmaliM, SteeleBt, PetricM, LimC.Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet1983,i: 619-620).

Mohemed Karmali

A kép forrása: Internet

A 80-as évek közepén igazolódott, hogy az STX1 és STX2 az E. coli lambdoid fágjain kódolt.

A későbbiekben azt is megfigyelték, hogy a Shiga bacillusban az  STX és az STX2E (az állati oedema betegség toxinja) kromoszómálisan helyezkedik el.

A Shiga szerű toxinnak két fő altípusa, az SLT 1 (Shiga-like toxin) és SLT 2 ismert. Az SLT2-nek pedig további altípusai, stx2a (német járvány), b, c, d, e (sertés oedema betegség) és léteznek. Az stx2e a globotriaosyl 4-hez kötődik. Elsősorban sertés kórokozó, de kimutatták emberi HUS kóroki tényezőjeként is. Néhány stx2 variáns a bél nyák hatására aktiválódik és a toxin letalitása fokozódik.

A Shigatoxin, a Cholera toxin, a Shiga szerű toxinok hasonlóan jutnak be a sejtbe. Sejtfelszíni receptorokhoz, a membrán lipid rétegében elhelyezkedő gangliozidokhoz kötődnek, majd retrograd transzport révén kerülnek a cytoplasmába. Bizonyos speciesek, pl. a marhák, disznók és őzek nem hordoznak a toxin megkötésére alkalmas gangliozid struktúrákat. Ezek a speciesek a béltraktusukban tünetmentesen képesek toxikogén coli baktériumokat hordozni, és az állatok székletével a baktériumok átkerülhetnek emberre.

A klasszikus epidemiológiai láncolat öt tagja a reservoir, a reservoirból való kijutás, a közvetítő, a behatolási út, és a gazda szervezet. A reservior és a reservoirból való kijutás a jelenlegi németországi E. coli járványban nem ismert.

Állati reservoirok

A verotoxin termelő E. coli törzsek esetében reservoirként olyan állatok bélrendszere szerepel, amelyekben a kórokozó baktérium tünetmentesen képes szaporodni. Ezek az előbb említett állatok és néhány madártörzs. A hordozás gyakorisága %-ban az USA-ban: szarvasmarhákban O157 3,7%, nem O157 stx termelő 23%, disznókban O157 1,5%, nem O157 stx pozitiv 4 %, bárányokban O157 2%, nem O157 stx pozitív 48%, szárnyasokban O157 1,5%, nem O157 stx pozitív 12%.  Kimutatták a STEC jelenlétét kecskékből, lovakból és kutyák bélrendszeréből is.

Nem O157 stx termelő törzsek előfordulása %-ban az USA-ban élelmiszer értékesítő hálózatokban forgalmazott nyers termékekben (Seattle, USA): borjakban 63%, pulykákban 7%, halakban 10%, kagylóban 5%.

A Shiga toxinnal asszociált klinikai szindrómák a dysenteria (Shigellosis), a haemorrhagias colitis (stx termelő E. coli törzsek, pl. EHEC) és a HUS.

A hasmenés súlyos, véres, nyákos diarrhoeae, abdominalis görcsök, kisérő hányás, és haemolysis előfordulása esetén véres vizelet észlelhető. A HUS a Shiga toxinnal fertőzött betegek 5-10%-ban fordul elő. A tünetek az infekció után néhány órán belül fellépnek, nagyobb dózis esetén rapidabb a lefolyás. A toxinnak antidotuma nincs, de kísérletes törekvések publikálásra kerültek. Ezek közé tartozik a később említett 4-APP (4-amino-pyrazolo (3,4-d) pyrimidine), amely gátolja az A alegység N glikozidáz enzimaktivitását. Kifejlesztésre került a synsorb Pk, amely Gb3 receptort silica patriculumokra absorbeálva tartalmaz, és szájon át történő bevitelével a bélben lévő szabad STX megkötésére alkalmas. Ez a terápiás eljárás azonban csak a bélben lévő toxin megkötését képes elvégezni, a már absorbeálódott és a vese endothel sejtjeihez kötődött toxint nem képes semlegesíteni. Ezekre az esetekre parenterálisan solubilis receptor analógokat, vagy anti-STX antitesteket próbálnak kifejleszteni. A sejtbe bekerült toxin gátlására a 4-APP lehet majd alkalmas. A hagyományos supportív terápia folyadékpótlás, az elektrolitok szintjének korrekciója, a vesefunctio ellenőrzése. A toxin rapid diagnosztikája szempontjából immunológiai vizsgálat rendelkezésre áll. A külső környezetben a toxin gőz sterilizálással, vagy oxidáló agensekkel mint hipó, vagy kémai ágenssel, pl. glutáraldehid, elpusztítható. A Shiga toxin LD50 értéke egérben kisebb, mint 20 ug/kg iv. vagy intraperitonealis bejuttatás esetén. Inhalációs bejutási útról közlés nem történt. Élelmiszer kontaminációval történő bejutás során azonban beszámoltak tüdőkárosító hatásról.

A Shiga toxin és a hasonló toxinok nomenklatúrája folyamatosan változott, az STX és a verotoxinok ugyanazt a toxin családot jelölik.

Shiga és az SLT (Shiga like toxin) szerkezeti felépítése

A toxin molekula teljes tömege 68000 D (Dalton), A és B alegységekből épül fel. Az A alegység molekulta tömege 32000 D, és ez az alegység felelős a fehérje toxikus hatásáért. A B alegység molekula tömege 7700 D és pentamer formában van jelen a toxinban. Minden B alegység 69 aminosavból áll. A pentamer struktúra felelős a sejtfelszíni kötésért. A B alegységek a sejtmembrán speciális gangliozid struktúrájához, a Gb3 (globotrioze) -hoz kötődnek. A kötődés keskeny tubularis membrán invaginációt eredményez. Ezeken a tubulusokon kerülnek a baktériumok, illetve a toxin a sejt belsejébe. A toxin két alegységét a furin vágja ketté, ami a toxin aktivációjához vezet. Az A alegység a sejt protein szekréciós útjával teljes ellentétes irányú úton jut el a riboszómák RNS komponenséhez. A stx azonban a sejtekbe a retrográd transzport mechanizmustól függetlenül is be tud lépni. Az A alegység, működését tekintve egy N glikozidáz enzim, amely adenint hasít le a riboszómáról, ezzel gátolva  a riboszómán zajló fehérje szintézist. A protein szintézis leállása végeredményben a sejt halálát okozza. A vaszkuláris endothel sejtek esetében alapvető az endothel réteg folyamatos megújulása. Az endothel sejtek pusztulása a vaszkulatura belső felületének pusztulásához, vérzésekhez vezet. Ezzel magyarázható a véres diarrhoeae tünetcsoport. A toxin rendkívül hatékony a kis erek endothel sejtjeinek elpusztításában, ezért a tünetek elsősorban a bélrendszerben, a tüdőben és a vesében jelentkeznek. A toxin kevésbé hatékony a nagyerek, nagy artériák és a nagy vénák endothel sejtjeinek károsításában. Ennek az az oka, hogy jelentős különbség van az STX/SLT (Shiga toxin like) receptor/receptorok expresszoiójában az egyes vaszkuláris területeken. A vese glomerulusokban az STX receptor expresszió rendkívül nagyfokú. A toxin specifikus targetje a glomerulusok vascularis endotheliuma. Itt az endothel sejtek pusztulása veseelégtelenséget, alkalmanként halálos HUS-t okoz.

További megfigyelhető célszervek a tüdő és a központi idegrendszer. A Shiga szerű toxin génje egyes kutatók szerint lambdoid profágból, a H-19B vagy a 933W profágból származik, amely transzdukció útján inzertálódott a baktérium kromoszómájába.

Megállapították, hogy in vitro rendszerekben az adenin megakadályozza a RIP-k (ribosomal inhibitory proteins, ilyen a Shiga toxin is) riboszómát inaktiváló folyamatát. Bizonyos állattörzsekben pl. egerekben azonban a nagy dózisú adenin nephrotoxikusnak bizonyult. A riboszóma inaktiváció mellett a növényi RIP-k és a Shiga toxinok képesek adenint eltávolítani a DNS láncról is, elsősorban in vitro. Felvetődött a RIP-k in viro DNS-t gátoló mechanizmusa is a pathogenezisben.

Az elmúlt évtizedben kifejlesztettek néhány purin derivátumot, illetve analógot, amelyek képesek az STX aktivitását gátolni a riboszómákon, és a DNS-en. A leghatékonyabbnak a Brigotti Més mtsai által kifejlesztett 4-APP (4-amino-pyrazolo (3,4-d) pyrimidine) bizonyult Brigotti M, Carnicelli D, Accorsi P, Rizzi S, Montanaro L, Sperti S. 4-Aminopyrazolo[3,4-d]pyrimidine (4-APP) as a novel inhibitor of the RNA and DNA depurination induced by Shiga toxin 1. Nucleic Acids Res 2000, 28, 2383-2388).

Maurizio Brigotti

A kép forrása: Internet

Az inhibitor nem nephrotoxikus, korábban daganat ellenes, cholesterin és lipoprotein csökkentő szerként használták. A 2000-es évektől a Shiga toxin toxikus hatásának gátlására is alkalmazzák.

A pertussis toxin (PTX) is kétkomponensű, és a heterodimer G proteinek működését változtatja meg. A PTX a baktérium kolonizációját és a betegségben megfigyelhető toxicus változásokat okozza. A PTX A alegysége (S1)ADP ribozyl transferáz, B alegysége pedig 5, az E. coli STX-hez hasonló polipeptid alegységből áll. A B alegység itt is specifikus sejtfelszíni szénhidrát struktúrához kötődik. Ezt követően az A alegység inzertálódik a membránba, majd direkt belépési mechnizmussal a citoplazmába kerül, enzimatikus aktivitása révén a NAD molekulák ADP ribosyl gyökét GI (inhibitoros G protein komplex) heterodimer kötött, heterotrimer G protein komplexre viszi. A GI normál funkcióban gátolja az eukaryota sejtek adenyl-cyclase aktivitását. Az ADP riboziláció révén a GI protein inaktiválódik és nem tudja ellátni adenyl-cyclase-t gátló működését. Az ATP cyclicus AMP-vé történő konverziója nem áll meg, és az intracellularis cAMP szint megnövekszik. Ennek számos sejt funkciójára káros hatása van, így a fagocyta sejtekben csökken a fagocyta funkció, a kemotaxis, a bekebelezés, az oxidativ burst és a baktricid aktivitás. A toxin szisztémás hatásai a következők. Megváltoztatja a cAMP által szabályozott hormonális működéseket, fokozódik az inzulintermelés, amelynek következtében hipoglikémia következhet be, nő a histamin érzékenység, ennek következtében fokozódik a kapilláris permeábilitás, hipotenzió, esetleg shock alakul ki. A toxin hatására limfocitosis lép fel, a nyirokszervekből kilépő B és T sejtek már nem képesek oda visszatérni. A szekunder immundeficiencia következtében a társuló infekciók gyakorisága fokozódik (pneumonia, otitis media).

Érdekes módon önmagában csak a béta oligomer kapcsolódása sejtfelszíni receptorával képes kiváltani az ADP riboziláció fokozódása nélkül is (A alegység hiányában) a limfociták mitogén aktivációjának, a thrombocyták aktiválódásának fokozódását és az inzulin szekréció növekedését. A pertussis toxin szekréciója az I-es típusú szekréciós rendszerrel történik.

A toxinok sejtbe való belépési mechanizmusa

A növényi toxinok, mint ricin (Ricinus communis), abrin (Abrus precatorius), modeccin (Modecca digitata vagy Adenia digitata), volkensin (Adenia volkensii) és a bakteriális toxinok, mint a Shiga toxin/verotoxin, Cholera toxinok, Diphteria toxin, Pseudomonas exotoxin A közös mechanizmussal lépnek be a sejtekbe. Egyik szerkezeti egységük kötődik a sejtfelszínhez, a másik szerkezeti egységük pedig a belépés után enzimatikusan inaktiválja a fehérje szintézist. Mind a ricin, mind a Shiga toxin citoszol célpontja a 60S riboszomális alegység 28S rRNS része. A Shiga toxin, a ricin, A és B alegységekből áll, a ricinben az A és B alegységek diszulfid kötöttek, míg a Shigatoxinban a diszulfid kötés az A alegység két része, az A1 és A2 között helyezkedik el. Mindkét toxin esetében az optimális enzim aktivitáshoz a diszulfid kötés redukciója szükséges. A Shigatoxin esetében a diszulfid kötés redukciója elött az A lánc A1 és A2 részének proteolitikus hasítása történik, amelyet a Golgiban és az endoszomákban lokalizálódó proteáz enzim, a furin végez. Ez a proteolitikus hasítás más bakteriális toxinok esetén is szükséges a toxinok aktivációjához. A ricin és a Shiga toxinok a riboszómákat támadják, a Diphteria toxin és a Pseudomonasexotoxin A pedig az elongációs faktor 2-t. Az eukaryota elongációs faktor 2 (EEF2, EF2, GTP dependens módon katalizálja a riboszómák pre transzlokációs állapotból post transzlokációs állapotba kerülését,  az A helyhez kötött peptidil-tRNS és a P-helyhez kötött  deacilált tRNS és mRNS kordinált mozgását és riboszómák konformáció változását (19pter-q12, 13 146 bp, 858 AA, 95338 Da, 452 fehérje kapcsolat, 298 SNP, www.genecards.org).

Az eredmény ebben az esetben is a protein szintézis gátlása. és végeredményben a sejtek pusztulása. A sejtbe való bejutás után a ricin és a Shiga toxin retrográd módon az endoplazmás retikulumba transzportálódik és azután innen transzlokálódik a citoszolba. A toxinok rendkívül hatékonyan gátolják a riboszómák működését, egy molekula ricin 2000 riboszómát képes percenként inaktiválni. Ezek a toxinok stabilak, ezért már egy, vagy néhány molekula is képes a sejtet megölni. A toxinok protein szintézist gátló hatása DNS fragmentációhoz, apoptózis szerű változásokhoz vezet. A Shiga toxinnal kapcsolatban felismerték, hogy a sejtpusztulás folyamatában alapvető a BCL2 család szabályozó szerepe is. A BCL2 gén és fehérje (B cell CLL/lymphoma 2, a BCL család apoptózis szabályozó protein család névadó, egyik fő antiapoptotikus tagja. A Bcl-2 integrált mitokondrium membrán fehérje, fokozott expressziója az immunglobulin nehézlánc lokusz területére történő transzlokációja következtében folliculáris limfoma kialakulásához vezet. A családnak vannak pro (Bax, Bak, Bid) és antiapoptotikus tagjai (Bcl-xl), BH (Bcl homológ domain, BH1-4) domainjeik összetétele szerint. A Bcl-2 gátolja a mitokondriális apoptózis utat, a citokróm c mitokondriumból történő kiszabadulását és az APAF-1 aktiválódását (apoptózis activating factor 1, citokróm c aktiválta apoptózis induktor, oligomer apoptosoma képző caspase 9 aktiváló fehérje). Bcl-2: 18q21.3, 169 783 bp, 239 AA, 26266 Da, 148 fehérje kapcsolat, 2691 SNP, www.genecard.org

A felsorolt toxinok a sejtfelszínen terminális galaktózt tartalmazó glikolipidekhez, glikoproteinekhez kötődnek. A kötés után a membrán invaginációja történik. A toxinok valamennyi ismert, endocytozissal kapcsolatos mechanizmussal bejuthatnak a sejtekbe. Ezek a következők: clathrin dependens (clathrin, dynamin, GTP mediált invagináció), cholesterin dependens, caveoláris (dynamin és GPT részvétellel), clathrin independens és végül makropinocytozis utakon, amelyek aktin és PI3K dependensek. A Shiga toxin endocytosisa elsősorban clathrin fedett vezikulumokban történik. Maga a toxin glikolipid receptorokhoz, a globo-triaosyl ceramid (GB3) struktúrához kötődik. A toxin-GB3 komplex aggregálódik és membrán bemélyedés alakul ki, amely clathrin- dynamin- GTP igényes folyamat. A clathrin (CLT) a fedett vezikulumok képződésében szerepet játszó, triskelion struktúrába felépülő fehérje, 3 nehéz és 3 könnyű láncból összeépülve polihedrális rácsot képez a vezikulumok körül. A burkoló proteinek kisméretű vezikulumokat körülvéve segítik elő a molekulák sejtek közötti transzportját. Az endo- és exocitózis során a vezikulumokban szállítódnak  nutriensek, szignalizációs receptorok, illetve a sejttörmelékek is ezekben hagyják el gyulladás során a szöveteket. Alkalmanként ez a mechanizmus különféle pathogén mikroorganizmusok és toxinok transzportját is végzi. Clathrin nehézlánc, (CLTCL1) 22q11.2, 112254 bp, 1640 AA, 187030 Da, 2 protein izoform, 66 fehérje kapcsolat, 1629 SNP, www.genecards.org). A dynamin GTP-áz enzim, amely az endocitozist szabályozza az eukaryota sejtekben. Levágja az újonnan képződött vezikulumokat a membránról és fúzionálja egy másik kompartment membránjába. A protein működésével internalizálódnak a caveolák, a clathrin fedett vezikulumok. A dynamin spirálisan rendeződik el a vezikula nyaki része köré, és konstrikciója következik be a GTP hidrolízisével, amely leválasztja a vezikulumot a membránról. Három különböző dynamin gént azonosítottak (dynamin I-III). A fehérjék részt vesz az organellumok osztódásában, a cytokinezisben és a mikrobiális patogének elleni védekezésben. Az aktin és más citoszkeletális fehérjék közreműködő partnerei a fehérjének. Dynamin 1 (DNM1) 9q34, 51870 bp, 864 AA, 97408 Da, 5 fehérje izoform, 114 fehérje kapcsolat, 630 SNP (www.genecards.org).

A Shiga toxin-receptor komplex sejtfelszíni kiterjedtsége és lokalizációja lipid raftokhoz kötött és sejttípus függő, ami befolyásolja a toxin intracellularis bejutását. Ez lehet az a tényező, ami meghatározza az érpálya egyes területeinek Shiga toxin érzékenységét. Néhány sejttípusban a Shiga toxin tirozin kinázok, mint Lyn (Src családba tartozó tyrosin kinase, lymphocyteantigen receptor-associated tyrosine kinase) és Yes (Yamaguchi sarcoma viral related oncogene homolog, Src családba tartozó tyrosin kinase) inaktivációját is kiváltja.

Az endocytozis után a toxinokat tartalmazó korai és a késői endosomák a Golgiba kerülnek.

A késői endosomák útja Rab9 (a rab fehérjék a ras GTPase szupercsaládba tartozó kis molekula tömegű monomer G proteinek, 70 humán rab fehérje ismert, az elnevezés acronym: ras in the brain) függő. A Rab9 az endoszoma és a transz Golgi közötti protein transzportban résztvevő ras családba tartozó G protein, a sejtmembránhoz prenilációval rögzül. Rab9A, Xp22.2, 21382 bp, 201 AA, 22838 Da, 9 fehérje kapcsolat, 167 SNPs.org. (www.genecard.org).

 A késői endosomákkal kerül a Golgi apparátusba a Shiga toxin processzálásában alapvető furin is. A furin párosan elhelyezkedő bázikus aminósavakat hasító enzim, proprotein konvertáz, amely prekurzor proteineket hasítva, azok aktiválását végzi. Kálcium dependens szerin endoproteáz, szubsztrátjai között szerepel a pro-parathormon, a TGF béta 1 prekurzor (TGF béta, transforming growth factor beta), pro- béta- szekretáz, von Willebrand factor, a HIV boríték gp 160 és gp 140 glikoproteinjeinek a hasításáért is felelős. A szekretoros út folyamatosan aktív enzime, amely a RX(K/R)R konszenzus motívumnál hasít.15q26.1, 14867 bp, 794 AA, 88678 Da, 49 fehérje kapcsolat, 220 SNP (www.genecards.org).

Azonban több toxin, így a Shiga toxin és a ricin is bekerül a Golgiba a korai endoszomális kompartmentből is. Ez a folyamat Rab9-től függetlenül zajlik. A Shiga toxin esetében a receptor lipid összetétele és a sejtmembrán cholesterin tartalma befolyásolhatja a toxin transzportját a Golgiba. A Golgiban a retrograd traszport első lépése a COPI (coat protein, ADP ribosylation factor (ARF)-dependent adaptor protein, coatomer protein komplex 1) fedett vezikulumok kialakulása. A COPI a fedett vezikulumokkal kapcsolatba lépő protein komplex, amely a Golgi komplex cisz végéről az endoplazmás retikulumba történő retrográd transzportban vesz részt. ADP ribozilációs faktor (ARF)-dependens adaptor protein. Az ARF-ok GTPase-k. COPB, a coatomer komplex alegysége, a nem clathrin fedett vezikulumokkal kapcsolódik. A protein elősegíti az anthrax lethal faktor endoszomális vezikulumokból történő felszabadulását is. 11p15.2, 56588 bp, 953 AA, 107142 Da, 837 fehérje kapcsolat, 428 SNP (www.genecards.org).

 A folyamat azonos a KDEL szignál szekvenciát (endoplasmás retikulum retenciós signál, Lys-Asp-Glu-Leu KDEL) tartalmazó fehérjék retrográd transzportjával.  Ezek a KDEL receptorokhoz (KDELR 1, 2, 3) kötődve visszatartódnak a Golgiban. Az említett toxinok közül néhány tartalmaz KDEL vagy KDEL-szerű signál szekvenciákat, ezek közé tartozik pl. a Pseudomonas exotoxin A és a Cholera toxin. Ezen toxinok hatása meggátolható a KDEL receptorok elleni antitestek alkalmazásával.

 A Shiga toxin és a ricin azonban nem tartalmaz KDEL szekvenciákat és mégis transzportálódik a Golgiból az ER-ba. Lehetséges, hogy KDEL receptorokhoz való kötődés nélkül is képesek a toxin molekulák transzportálódni a COPI fedett vezikulumokban. A COPI antitestekkel történő gátlása azonban nem függeszti fel a Shiga toxin retrográd transzportját. Újabban kimutatták, hogy a retrograd Shiga és ricin transzport Rab6 (Golgin belüli transzportot szabályozó rab protein) függő. A Shiga toxin ER-ba kerülése után az ER (endoplasmic reticulum) rezidens chaperonok és enzimek redukálják a belső diszulfid-kötéseket és elősegítik a toxinok A alegységeinek transzportját a cytosolba a SEC61P komplex révén (secretion, az emlős sejtek ER és az ER-Golgi intermedierjeinek membránjába integrálódó oligomer, alpha, béta és gamma láncokból felépülő translocon, transmembrán csatorna, amelyen keresztül a fehérjék transzlokálódnak. A protein komplex három fehérjéből -alpha, béta gamma-felépülő oligomer, SEC61A2, alpha2 alegység, a komplex membrán inzercióban szereplő tagja. 10p.14, 40325 bp, 476 AA, 52248 Da, 2 fehérje izoform, 29 fehérje kapcsolat, 517 SNP, www.genecards.org). A protein komplex fiziológiásan az újonnan szintetizálódott proteinek citoszolból az ER-ba történő transzportjában vesz részt, de szükséges a misfolded (nem megfelelő térszerkezetű) fehérjék citoszolba való visszakerüléséhez is, ahol ezek ubiquitálódnak és a proteaszomákban degradálódnak. Megfigyelték a Cholera toxin esetén, hogy az intakt toxin ER-ba történő érkezése után a diszulfid izomeráz enzim redukálja az A alegység diszulfid-kötését, és elősegíti az aktív A1 alegység kiszabadulását, amely ezután traszportálódik a cytosolba. A SEC61P protein komplex elősegíti néhány toxin, így a ricin A lánc, a Cholera toxin, a Pseudomonas exotoxin A transzportját is. A ricin és a Shiga toxin belső diszulfid láncának redukciója és a transzlokáció részletes lépései még nem ismertek, úgy tűnik azonban, hogy a toxin B alegysége is transzlokálódik az ER-ból a cytosolba.

Egyéb proteinek is transzportálódnak a retrográd transzport mechanizmussal a sejt felszínéről a citoszolba. A CD19 (A B limfocitákon és a folliculáris dendritikus sejteken expresszálódó sejtfelszíni molekula. B sejt coreceptor, a CD21-el és a CD81-el együtt a sejtfelszíni immunglobulin receptor komplex része. A B sejt receptor aktiváció során a CD19 citoplazmatikus része foszforilálódik, és src kinázok és PI-3 kinase megkötődése jön létre. A coreceptorok a megfelelő B sejt antigén receptor jelátvitelhez szükségesek. CD19: 16p11.2, 7409 bp, 556 AA, 61128 Da, 39 fehérje kapcsolat, 91 SNP, www.genecards.org), amely a Shiga toxin B láncához hasonló aminosav szekvenciájú, szintén kötődik a GB3 Shiga toxin receptorhoz, és a B sejtekben apoptózist indukál. Több növekedési faktorról is kimutatták, hogy a retrográd transzporton keresztül jut a sejtmagba.

A retromer protein komplex

Az evolúció során tartósan megőrződött protein komplex a retromer, amelynek az a feladat, hogy kiválogassa a korai endosomákból a szállítandó tartalmat és visszairányítsa a transGolgi hálózatba. Az élesztőkben ezek a fehérjék a VPS 26P, 29P és 35P (vacuolar protein sorting), a karbo szelectív subkomplex tagjai. A membránnal kapcsolatban lévő subkomplex tagok a VPS 5P és 17P. A membránnal kapcsolatban lévő tagok az un. sorting nexinek (SNX). A proteinek SNX-PHOX(phagocyte oxidase) homológ (SNX-PX phosphoinositide-binding structural domain) domainjükkel kapcsolódnak a foszfoinozitidekhez. Az emlős retromer karboszelektív szubkomplexe hasonlít az élesztőéhez. A sorting nexin 1 és 2 szükséges az endoszomák transGolgi hálózatba történő retromer mediált transzportjához. A sorting nexin 5 és 6 szintén alapvető retomer komponenseknek bizonyultak. A sorting nexinek az SNX-PX domain mellett még membrán kötött karboxi terminális BAR (Bin /Amphiphysin, RVS Arg-Val-Ser) domaint tartalmaznak. Ez egy dimerizációs motivum, görbült, rigid struktúra, a konkáv felszín alkotja a membránkötő részt. Ez a konkáv felszín lép kapcsolatba a sejtmembránok pozitív görbületi területével, ami a kis vesiculumok területén vagy a keskeny átmérőjű membrán tubulusokban található. A BAR domaint tartalmazó SNX1 fehérjék indukálják a nagyobb görbületű membrán tubulusok kialakulását, polimerizálódott helikális réteg kialakításával. Az emberi retromer-SNX komplex alakítja ki és definiálja a korai endosomák tubularis subdomainjét. Az SNX réteg dokkoló felszínként szerepel a karboszelektív VPS 26, 29, 35 subkomplex felépüléséhez. Először a VPS 35 speciális sorting signal észlelésével kötődik az SNX komplexhez, ami elindítja a retromer komplex felépülését az SNX subdomainen. A retromer így összekapcsolja a membrán deformitást a kiválogatás folyamatával. A retromer kutatások az elmúlt egy-két évben több pathofiziológiai állapotban is jelentőséget kaptak, így az Alzheimer kór patogenezisében is, ahol a retromer szabályozza a béta amiloid prekurzor protein és processzáló enzimei, a béta és gamma secretázok kiválogatódását. Az emlősökben négy féle retromer valószínűsíthető. A hatékony retromer kiválogatás az endoszomális hálózat dinamikus térbeli átrendeződését igényli. Ez az SNX 5, 6, a dinactin P150 komponense (A dynactin komplex 10 alegységből felépülő makromolekuláris motoros fehérje komplex, kapcsolódik a citoplazmában lokalizált dyneinnel és a mikrotubulusokkal részt vesz a transzportfolyamatokban, az osztódási orsó kialakulásában, a kromoszomák mozgásában, axonogenezisben), a vég irányította mikrotubularis dynein motorfehérje, az SNX1 és a transzGolgi hálózatba lokalizált RAP6 –interacting protein 1-neltörténő kapcsolódások révén alakul ki (RAP6-Rab5-activating protein6, endosomális fehérje, az endocytosis folyamatában szerepel) (SNX1 homodimer, a retromer komplex tagja, összetétele VPS26A vagy VPS26B, VPS29, VPS35, SNX1, SNX2, 15q22.31, 48 257 bp, 522 AA, 59070 Da, 37 fehérje kapcsolat, 662 SNP, www.genecards.org).

Az STX termelő vagy STEC (ESTEC) E. coli emberi fertőzések epidemiológiája

Az E. coli O157:H7 élelmiszer közvetítette hasmenést okozó pathogén szerepe egy haemorrhagis colitis járvány során 1982-ben került azonosításra az USA-ban. A véres hasmenés kontaminált hamburger fogyasztását követően alakult ki. A következő évben derült fény az O157:H7 törzs Shiga toxin termelő képességére. Az ezt követő tíz évben több mint harminc E. coli O157:H7 járvány kitörését regisztrálták az USA-ban. A tényleges számot ennél sokkal nagyobbra becsülik, mert az E. coli O157:H7 infekciók 1987-ig nem voltak bejelentésre kötelezettek az USA-ban. Általában a geográfiailag koncentrált, nagyobb járványok keltettek kellő figyelmet a vizsgálatok elindítására. Lényeges körülmény az is, hogy az esetek mintegy 10%-a jelentkezik járványként, a többi sporadikus. A CDC becslése szerint az E. coli O157:H7 járványok 85%-a kontaminált élelmiszer közvetítésével jön létre.

Gyakorlatilag bármilyen kontaminált élelmiszer vagy ital közvetítheti a betegséget.

1990-1992 között 10 USA orvosi központ szolgáltatott klinikai és epidemiológiai adatokat E. coli O157:H7 fertőzésekről. A vérzéses hasmenések kóroki tényezői közül a legfontosabb az E. coli ESTEC O157 fertőzés volt. Az előfordulási esélyhányados (OR, odds ratio) 16,6, sokkal gyakoribb volt, mint a Campylobacter, a Salmonella, vagy a Shigella fertőzés. Hasgörcsöket tekintve az O157:H7 OR 3,0, abdominális érzékenység szempontjából az OR 4,2, a másik három baktériumhoz viszonyítva. A láz előfordulása ritkább volt, OR 0,26, látható vér a székletben is jelentősen gyakoribb, OR 20,4, nem látható de haemoccult pozitív széklet előfordulás OR 4,6, székletben leukocyta jelenléte OR 4,0, látóterenként több mint 10 fvs előfordulás OR 2,1.

Az USA-ban a legnagyobb O157:H7 kitörés 1993-ban volt, mely több mint 700 személyt érintett (Jack in the Box étterem lánc, hamburger), 4 gyermek meghalt.

A kórkép típusos lefolyása: 3-4 nap inkubáció, ez alatt az idő alatt a vastagbél colonizálódik, a baktérium szaporodik, majd a betegség nem véres diarrhoeae-val és hasi görcsökkel kezdődik. A hasmenés 2-3-dik napján véres széklet alakul ki, a betegek általában ekkor fordulnak orvoshoz. A hasmenés rendeződik, általában egy hét alatt javul, de az esetek 6%-ban HUS szindróma alakul ki. Más ESTEC coli törzsek esetén az inkubáció és a HUS kifejlődésének aránya nem került meghatározásra. Bár az ESTEC törzseket általában egy csoportnak tekintik, az egyes szerotípusok között fontos különbségek lehetnek. Ezt a különböző virulencia faktorok jelenléte magyarázza. Az ESTEC O26:H11 STX 1-et termel, az O157:H7 törzseknek azonban mindössze 2%-a STX1 termelő. A nem véres hasmenést általában gyakoribbnak tartják a nem O157 ESTEC törzsek esetén, mint az O157:H7 törzsek okozta betegségben.

A nem O157 ESTEC törzsek gyakrabban izolálhatók a vérből és a vizeletből, mint az O157:H7 törzsek,  jelezve, hogy a nem O157 ESTEC törzsek betegség spektruma szélesebb.

Az ESTEC fertőző csíraszám dózisa nagyon alacsony. Az 1993-as US járvány esetén kevesebb mint 700 E. coli O157:H7 baktérium volt jelen hamburgerenként a sütés előtt, és elég sok gyermek csak 1-2 harapásnyit fogyasztott. Az 1994-es E. coli O157:H7 szalámi okozta fertőzés esetén a becsült kórokozó szám kevesebb mint 50 organizmus lehetett. A szintén Amerikában észlelt E. coli O111:H- szalámi okozta járvány csíraszám mennyisége kevesebb, mint 1 coli baktérium volt 10 grammonként.

Az 1990-92 közötti eseteket összefoglaló multicentrikus tanulmány szerint (30 000 széklet mintát vizsgáltak) 0,4%-ban találtak E. coli O157-t, 2,3%-ban Campylobactert, 1,8%-ban Salmonellat és 1,1%-ban Shigellát. Az E. coli O157 fertőzések voltak klinikailag a legsúlyosabbak, a betegek 47%-a került kórházba, Campylobacter infekció esetén 21%, Salmonella esetén 38%, Shigella esetén 25%-uk igényelt hospitalizációt.

Az E. coli O157 fertőzések az USA északi államaiban gyakoribbak, mint a déli államokban, a populáción belül az 5-9 éves gyermekekben és az 50-59 év közötti felnőttekben volt a kórkép a leggyakoribb. Az infekciók a nyári hónapokban gyakoribbak, mint télen.

A nem O157 STEC hasonló adatai ritkák, az O157:H7 és a nem O157 STEC arány a hasmenéses mintákban 1,8/2:1-hez. Németországban ezzel szemben az arány 0,2-0,4:1. Az USA-ban 1996-ban kezdődött az ún. Foodborne Disease Active Surveillance Network (FoodNET surveillance system), ami az O157:H7 és más patogének szűrését végzi hét helyszínen, 18 millió személy szűrésével. Az EU-ban 1997-ben, hazánkban 1998-ban (18/1998. (VI. 3.) NM rendelet. A fertőző betegségek és a járványok megelőzése érdekében szükséges járványügyi intézkedésekről) kedődött meg a bejelentési és surveillance tevékenység.

Azt gondolják, hogy az O157 törzsek virulensebbek, mint a többi Shiga toxin termelő coli törzs. Jelenleg minden részletében még nem tisztázott, hogy mi ennek a fokozott virulenciának az oka a többi, nem O157 ESTEC törzzsel összehasonlítva. A legfontosabb virulencia faktoroknak a Shiga toxin 2 és az intimin termelő képességet tartják az O157 törzsek esetében. A többi virulencia faktor, mint az enterohaemolysinek, a serin proteáz (EspP, E. coli secreted protein P), a kataláz/peroxidáz (Katp), a haemoglobin felhasználás, a clostridium difficile szerű toxin, a limfocita funkciót gátló faktorok, valamint az enteroaggregatív hőstabil toxinok jelenléte az alacsony csíraszámú fertőzésekben talán kevésbé jelentős. Összehasonlították a Shiga toxin termelő O157 és nem O157 törzsek virulencia sajátosságait. Úgy gondolják, hogy az O157 STX termelő törzsek klonális eredetűek, fenotípusos és genotípusos sajátosságaik igen hasonlóak. A fő STX termelő szerotípus O157:H7, de alkalmanként az O157:H- non motilis variánst is izolálták hasmenéses esetekből. Az O157 E. coli törzs biokémiai reakciói hasonlóak a többi coli törzséhez, de néhány eltérést is találtak. Az O157 izolátumok egy része nem fermentál sorbitolt 24 óra alatt sem, és nem termel béta glukuronidázt (ezeket a tulajdonságokat az izoláció és azonosítás során kihasználják). A korábbi németországi O157 fertőzések izolátumaiban megfigyeltek azonban sorbitol fermentáló és béta glukuronidázt termelő törzseket. Úgy gondolják, hogy ezek egy különböző O157 E. coli  klón tagjai. Az O157 törzsek shiga toxint termelő képessége is különböző. A legtöbb izolátum csak Shiga toxin 2 variánst termel, alkalmanként azonban megfigyelhető Shiga toxin 1 és 2 együttes termelődése, és igen ritkán észleltek csak Shiga toxin 1 termelést. Az O157 E. coli törzsek izolátumainak többsége tartalmaz egy nagyméretű, 60 megaDa-s plazmidot (jelölése pO157). A plazmid azonosítására a CVD 419 DNS szekvencia (3.4 kb méretű EHEC plazmidból készített próba) próbával történő hibridizációt alkalmazzák. A plazmid szekvenciája ismert, és több lehetséges virulencia faktort azonosítottak a plazmidon. Néhány O157 izolátum kisebb méretű, 6,7 kb plazmidokat is tartalmaz, ezek az O157:H7 colicinogén fenotípusok.

A bacteriocinek protein toxinok, amelyek gátolják a hasonló, vagy rokon bakteriális törzsek növekedését. Általában szűk spektrumú antibiotikumoknak tarthatók és fenomenológiailag analógok az élesztő és a Paramecium (papucsállatka, csillós egysejtű nemzetség) killing faktoraival. Struktúrálisan, funkcionálisan és ökológiailag azonban különbözőek. A bacteriocineket André Gratia (1893-1950, a penicillin felfedezője, Alexander Fleming kollégája) fedezte fel 1925-ben, annak kapcsán, hogy a baktériumok elpusztítására végzett kísérleteket. Az első ilyen molekulát colicinnek nevezte, mert elpusztította az E. coli baktériumot.

André Gratia 1893-1950

A kép forrása: Internet

A bacteriocineket többféleképpen lehet osztályozni, a termelő törzs, a rezisztencia mechanizmus, vagy a killing mechanizmus figyelembe vételével. Az első osztályozás alapján a Gram pozitív baktériumok bacteriocinjei a colicinek, az Archeaké a mikrocinek, a coli-ból származók szintén colicinek (korábban colicineknek a coli killereket nevezték). A colicinek a legrégebben tanulmányozott bacteriocinek, diverz molekulák és nem jelentik a coli által termelt összes bacteriocint. A legöregebb colicin a colicin V, jelenleg microcin V-nek nevezik. Ez sokkal kisebb méretű és termelődése különbözik a klasszikus colicinektől. A másik klasszifikációs lehetőség a killing mechanizmus. Ez lehet pórus kialakítás, DN-ase, nuclease aktivitás, a murein termelődés gátlása. Az elnevezés történhet a kódoló struktúra alapján, ami vagy kis plazmid, vagy kromoszóma, a molekulasúly, vagy a kémiai szerkezet alapján, így nagyméretű protein, polipeptid, szénhidrát oldalláncot tartalmazó, vagy nem tartalmazó fehérje, vagy atípusos aminosavakat tartalmazó protein pl. lantionin. Osztályozhatók továbbá a termelődésük alapján, riboszómális, postriboszomálisan modifikált vagy non-riboszomális fehérjékként.

Az egyik klasszifikáció a bacteriocineket I, IIA, IIB, IIC, III osztályba sorolja. Az I osztályú bacteriocinek kisméretű peptid inhibitorok, a nisin és a lantibioticumok.  A II osztályú bacteriocinek kis hőstabil fehérjék. IIA osztályúak a pediocinek, ezek N terminális konszenzus szekvenciát tartalmaznak (Tyr-Glu-Asp-Glu-Val-XAA-Cys). Potenciálisan alkalmazhatók élelmiszer tartósítására és gyógyászati célra, különösen Listeria ellenes aktivitásuk jelentős. A IIB bacteriocinek két peptid tartalmúak, a IIC bacteriocinek cirkulárisak. Megváltoztatják a membrán permeábilitást, a sejtfal architecturát. A III. osztályú bactericinek nagy, hőlabilis proteinek

A fontosabb bacteriocinek a következők: agrocin, alveicin, aureocin, carnocin, colicin, curvaticin, divercin, enterocin, enterolysin, epidermin, erwiniocin, glycinecin, halocin, lactococin, lacticin, lecuccin, mesentericin, nisin, pediocin, lantaricin, sakacin, suktilin, sulfolobicin, thuricin17, trifolitoxin, vibriocin, varnerin.

A colicinek az E. coli toxicus proteinjei, amelyet bizonyos coli törzsek termelnek. Több mint 20 colicint azonosítottak. A bakteriocinek közé tartoznak, a külső környezetbe kerülve meggátolják más baktérium törzsek szaporodását, gátolván a kompetíciót. Fehérjékkel komplexben szekretálódnak, ezek gátolják a saját sejtekre gyakorolt toxicus hatást.

 A colicinek a külső membrán receptor struktúráihoz kötődnek, ezek segítéségével transzlokálódnak a citoplazma membránba vagy a citoplazmába és különböző citotoxicus hatásokat fejtenek ki, mint a citoplazma membrán depolarizációja, DN-ase, RN-ase aktivitás, murein szintézis gátlás stb.

Szerkezetüket tekintve három domainból állnak, az N terminális rész a transzlokációs domain (1-190 AA) a col Ia-ban, a középső a receptor kötő domain (kb.190-451AA) és a C terminális citotoxicus domain (kb. 452-626 AA). A colicinek egyik típusa membrán csatornát alkotó colicin (ABE1, Ia, Ib, és N), ezek transzmembrán fehérjék és a sejt energia termelését kivezetve depolarizálják a citoplazma membránt. Az N terminális transzlokációs domain keresztül halad a külső membránon és a periplazmikus téren, a centrális domain kötődik a megfelelő receptorhoz és a C terminális citotoxicus domain képezi a citoplazma membrán csatornát. A nem pórusformáló colicinek a cytoplasmába transzlokálódnak, kötődnek a cellularis targethez és a citotoxicus domain pl. nukleáz aktivitást kifejtve feldarabolja az RNS-t vagy a DNS-t. A legtöbb colicin a külső membránon két receptor rendszert használva transzlokálódik.

Az A csoportú colicinek a BtuB (B/12/ twelve uptake) receptorhoz kötődnek, ami az E. coli sejtek B12 vitamin felvételében szerepet játszó receptor. A receptorhoz való kötődés a receptor kötő domain szétcsavarodásához vezet, ami az ún. immunitás fehérje leválását okozza és elindítja a colicin transzlokációját. A többi colicin is általában kisméretű, növekedést elősegítő metabolitok felvételét irányító pórusokhoz kapcsolódik.

 Az első receptor a kezdeti kötést, a második receptor a transzlokációt segíti elő. A kezdeti kötésért felelős sejtfelszíni receptorok általában porinok, Omp F, FepA, BtuB, Cir (cathecolat típusú ferri ion transzporter – iron, és vas regulált colicin 1 receptor, porin), FhuA. A colicineket a receptorhoz való kötődés szerint is klasszifikálják. Felvételük a sejtbe specifikus periplazmikus proteinekkel történik. Az A csoportú colicinek a Tol fehérje rendszer öt proteinjén keresztül lépnek be a sejtbe, ezek a TolA, B, R, Q, (tolerance), Pal (Tol-Pal system, peptidoglycan associated lipoprotein). Az A csoportú colicinek a transzlokációhoz  co-receptorokat is igénybe vesznek, ezek a TolC, OmpC, OmpF, és PhoE (trimer külső membrán porin, phosphate-limitation-inducible outer-membrane protein). A B csoportú colicinek a Ton rendszer fehérjéin, a TonB, ExbB, Exb T, ExbD fehérjéken keresztül lépnek be, co-receptor nélkül. A sejtek elpusztítása végeredményben a pórus kialakításán, DN-ase, 16S RN-ase és tRN-ase aktivitáson alapul.

Valamennyi colicin plazmidon kódolódik. Általában két colicinogén plazmid található a baktériumokban, a nagyméretű, alacsony kópia számú plazmid, és a kisméretű, nagy kópia számú plazmidok. A nagyméretű plazmidok más géneket is hordoznak, köztük a colicin operont.

A colicin operon három fő génből, az immunitás génből, a colicin strukturális génből és a bakteriocin lysis/release protein génből áll. Az immunitás gén folyamatosan működik, az átíródási irány a colicinével ellentétes. A bacteriocin release protein azonban a colicin strukturális gén stop kódonján áthaladó leolvasással aktiválódik. A colicin expressziót az SOS regulon szabályozza, ennek egyik része a LexA (DNS kötő represszor fehérje, kötődik az SOS box szekvenciához /TACTGTATATATATACAGTA/), ami represszálja a gént. DNS károsodás esetén az egyszálú DNS felhalmozódása aktiválja a RecA /recombinase/ proteint, amely kötődve a LexA hoz elindítja annak autoprotease aktivitását. A LexA két részre hasad, és elveszíti represszor aktivitását, így az SOS regulon aktiválódik, elindul a DNS repair) represszor fehérje, amely több colicin expresszióját gátolja.

Járványok az USA-ban

Az első haemorrhagias colitissel asszociált E. coli O157:H7 kitörést  1983-ban publikálták a New England Journal of Medicine hasábjain (Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, Hebert RJ, Olcott ES, Johnson LM, Hargrett NT, Blake PA, Cohen ML.Hemorrhagic colitis associated with rare Escherichia coli serotype. N Engl J Med1983; 308:681-685).

Lee W Riley

A kép forrása: Internet

1982-1996 között 139 E. coli O157:H7 járvány volt az USA-ban, több mint 3000 megbetegedést regisztráltak, 22%-uk igényelt kórházi kezelést, 6% -ban lépett fel HUS vagy TTP (trombotikus trombocitopéniás purpura) és a betegek 0,6%-a halt meg. A járványok gyakoribbak voltak az északi államokban. Ezt az új surveillance rendszer is megállapította. A leggyakoribb transzmissziós út étel (67%), ezt követi az emberről-emberre történő átvitel, rendszerint óvodákban, napközikben (22%), valamint a víz, uszodákban (8%), ivóvízzel (2%).

Az étel által közvetített fertőzések leggyakoribb helyszínei a következök voltak: otthoni, éttermi, táborokban és iskolákban szerzett megbetegedések. Az otthon szerzett fertőzések magas aránya új tendencia és a surveillance rendszer eredményességének köszöhetően sikerült a fertőzéseket felismerni, mert a rendszer kisebb kitöréseket is képes volt detektálni. A leggyakoribb E. coli O157 fertőzést közvetítő élelmiszerek az USA-ban a darált marhahús, marhasült, szalámi, nyers tej, szarvashús, sárgadinnye, lucerna csíra, saláta, almabor, nem pasztörizált alma juice.

A nem O157 STEC törzsek a surveillance rendszer korlátai miatt ritkábban kerülnek felismerésre.

1990-ben észleltek egy E. coli O111 ac:NM (non motile) családi clustert, amelyben egy 15 hónapos lány HUS-ban meghalt.

1994-ben egy ritka szerotípust találtak, mely haemorrhagias colitist okozott, és 4 embert érintett. A helyi laborban csak azt tudták megmondani, hogy nem O157 :H7 törzsről van szó. A CDC azonosított egy STX2 termelő O104:H21 törzset. A későbbiekben 18 betegben mutatták ki a kórokozót, legtöbbjüknek nem véres hasmenése volt. Láz 40%-ban fordult elő és 22%-ban került sor kórházi kezelésre. Ezek között azonban HUS, vagy haláleset nem fordult elő. A fertőző forrás a pasztörizáció után a tejüzemben kontaminálódott tej volt. A törzs abban az értlemben is szokatlan volt, hogy hiányzott az E. coli eaeA (attaching and effacing) génje.

A törzsek tipizálásának fejlődése, a subtípusok megállapítása a surveillance javulásával lehetővé teszi az egyes járványok szétszóródott eseteinek azonosítását. Lehetővé válik a látszólag sporadikus esetek közös vektorra, illetve rezervoirra való visszavezetése.

Erre példa 1997. június-júliusban egymástól sok száz mérföldre észlelt Michigen és Virginia államokbeli esetek azonosítása. A betegség súlyos kimenetelű volt, 70 beteget azonosítottak, 97%-ban járt véres hasmenéssel és 51%-uk került kórházba. A fertőzés közvetítője lucerna csíra volt. A subtipizálást ekkor már Pulse Field Gél Elektroforézissel végezték (PFGE). Azonosították a magvakat is, amelyekből a csírákat növesztették és visszakövetéssel kiderítették, hogy a magok csak ebben a két államban kerültek forgalmazásra. Lehetővé vált a fertőzött magvak kereskedelmi forgalomból való kivonása. A subtipizálás több epidémiában is lehetőséget nyújtott a közvetítők azonosítására. Az egyes járványokban saláta, alma juice, valamint fagyasztott darált marhahús (hamburger járványok esetében) szerepelt közvetítőként. A CDC a subtipizálásra a PFGE technikát (a tipizálási technikák leírását később ismertetjük) alkalmazza a surveillance laboratóriumokban. A CDC nemzetközi adatbázisában az E. coli O157:H7 törzs subtípusainak PFGE mintázata tárolásra kerül  és ezzel tudják összehasonlítani a helyi mintázatokat a laboratóriumok.

Az 1993-as hamburger járvány után szigorú guideline-kat javasoltak a hamburger sütési  hőmérsékletével és idejével kapcsolatban. 1994-ben nyilvánosságra hozták, hogy az E. coli O157:H7 volt a nyers darálthús szennyezője. Az US Department of Agriculture új kezelési útmutatót és cimkézést fejlesztett ki. 1996-tól új hús inspekciós gyakorlatot vezettek be, megváltoztatták a szalámi gyártási előírásokat is. Felismerték, hogy a szarvasmarhák és a szarvasok az E. coli O157:H7 fontos rezervoirjai és javították a saláta feldolgozási metódusokat is. A legnagyobb amerikai friss alma juice előállítók pasztörizációt vezettek be, és azokat a tejüzemeket, amelyek nem megfelelő higiéniai eljárásokat követtek és felelősek voltak O157:H7 fertőzések kitöréséért, bezárták.

Shiga toxin termelő E. coli fertőzések az Európai kontinensen

Az első, étel által okozott ESTEC O157 betegséget 1982-ben észlelték az USA-ban. Itt és az Egyesült Királyságban is gyakorlatilag azonnal kiderült, hogy a baktérium súlyos közegészségügyi problémát jelent. Ezzel szemben a kontinentális Európában lényegesen ritkábban figyeltek meg ESTEC O157 fertőzést. A kontinensen az első felismert haemorrhagiás colitist Belgiumban írták le 1987-ben. Az első, ESTEC O157 által okozott HUS-t Németországban ismerték fel 1988-ban. Valamennyi, azóta közölt tanulmány a STEC emberi előfordulásáról azt állapította meg, hogy a sporadikus és a járványos fertőzések előfordulása ritkább, mint az USA-ban vagy az UK-ban. Az 1990-es évektől azonban nagyobb járványokat is észleltek. Európában a kérdésre specializálódott szervezetek az European Study Group on EHEC, a SALMNET-Enternet Network és az European V-Tech Club.

Az európai STEC törzsek O szerotípusai a 90-es években a következők voltak: O157, O26, O111, O103, O128, O91, O113, O2, O9, O145, OX3, O1, O8, O22, O121, O146, O5, O18, O117, O118.

Adatokat a következő országok szolgáltattak (csökkenő sorrendben): Ausztria, Belgium, Csehország, Finnország, Franciaország, Németország, Görögország, Magyarország, Olaszország, Norvégia, Szlovénia, Spanyolország, Svédország, Hollandia.

Szórványos STEC O157 eseteket jelentettek Szerbiából, Portugálióból, Horvátországból, Máltáról, Lengyelországból, és Törökországból.

Az ESTEC előfordulás gyakorisága a hasmenéses betegek között országonként a következő: 2% feletti Németországban, Hollandiában, Ausztriában és Svájcban, 1% alatti Olaszországban és Szerbiában.

Az ESTEC izolátumok között az O157 törzsek előfordulása kevesebb, mint egyharmad.

ESTEC és ESTEC O157 pozitivitás országonként

Magyar                                  -                                 0,8

Német                                  9,3                                2,7   1988-91

Holland                                4,0                                2,0   1989-93

Német                                  2,8                                0,4   1994

Ausztria                               2,8                                0,4   1995

Svájc                                    2,0                                0,6   1996-97

Finn                                     1.4                                0,6   1996

Spanyol                                1,3                                0,2   1992-95

Svájc                                    1,2                                 0,0  1990

Cseh                                     1,1                                 0,2  1988-95

Belgium                               1,0                                 0,2  1990-95

Olasz                                    0,8                                 0,0  1992

Szerb                                    0,3                                 0,0  1993   

HUS incidencia  (100 ezer lakos, 0-15 éves korosztály)

Dél-Német(Bavaria)       1,9

Holland                           1,5

Svájc                               1,5

Belga                               1,4

Litván                              1,0-2,0

É-Német                          1,0

Francia                             0,7

Ausztria                           0,4

Olasz                               0,2

Málta                               0,0

Az O157 és más ESTEC szerocsoportok azonosítása LPS elleni antitestekkel történik. A HUS betegekben a STEC pozitív betegek aránya 61-93%. A legtöbb HUS esetben STEC O157 fertőzést azonosítottak. STEC járványok Europában sokkal ritkábbak, mint az USA-ban. 17 járványt írtak le 9 országban és 10 másik országból azt jelentették, hogy egyáltalán nem volt STEC járvány (Ausztria, Belgium, Horvátország, Dánia, Görögország, Málta, Norvégia, Lengyelország, Szlovénia, Svájc).

Az első E. coli járványt Európában Magyarországon írták le 1977-ben, de ekkor még nem tudták azonosítani, hogy ez ESTEC járvány volt-e, vagy nem. Később, retrospektív vizsgálattal igazolták a coli törzsek STX termelését.

A legtöbb európai járvány (14/17) a 90-es évek közepéig fordult elő, és elsősorban STEC O157 okozta, de 7 járványban nem O157 STEC törzsek szerepeltek kórokozóként. Két járványban pedig 2 különböző szerotípus fordult elő együttesen.

8 epizód limitált volt, családokban, iskolákban, idősek otthonában, kórházakban emberről-emberre terjedve alakult ki. 9 kitörést HUS fellépés következtében detektáltak. Az ESTEC pozitivitás a HUS esetek 27-93%-ban volt jelen és ezek közül az O157 pozitivitás 0-83%-ban fordult elő.

Ezeket a járványokat a következő ESTEC szerocsoportok okozták

Ország              év                   szerocsoport        előfordulási hely    HUS

Magyar            77                          O26                  kórház                    ?

Német               88                          O157                egyházi                    6

Cseh                  88                    O157, O26             idősek otthona         5

Magyar            90                          O157                család                      0

Magyar            91                          O157                   ?                            0

Német              92                           O157                iskola                       3

Olasz                92                          O111                 közösség                  9

Francia             92                          O111                 közösség                 10

Francia             92                          O119                 közösség                  4

Német              93                          O157                 család                       1

Holland            93                          O157                 közösség                  4

Olasz                93                    O157, O111            közösség                 15

Spanyol            95                         O111                  iskola                       0

Svéd                 95                         O157                  közösség                 29

Cseh                 95                         O157                  közösség                  ?

D-Német        95-96                      O157                  közösség                 47

Finn                  97                         O157                  közösség                  1

Tanulságul megállapítható, hogy az európai járványokban kevesebb eset fordult elő, mint az USA-ban. Ezt az amerikaiak az európai surveillance rendszer hiányosságaival magyarázzák. Az amerikai és angol járványokat elsősorban a nem kellően átsütött hamburgerek okozták. Az európai járványok közül 7 esetben a közvetítő tényező már akkor sem derült ki. Egy magyar járvány közvetítője élelmiszer volt, l kecsketej, 1 kecskesajt, a többi emberről emberre történő (3), uszodavíz (2), illetve ivóvíz közvetítéssel jött létre. Egyetlen európai járványban sem volt nem kellően sült hús a közvetítő. Az epizódok egy részében vidéki környezet, a kérődzők trágyájával való kontamináció szerepelt. STEC törzsek számos országban voltak jelen szarvasmarhákban, sertésekben és birkákban. 11 országban detektáltak STEC törzseket egészséges marhák bélrendszerében. Az állatokban a törzsek hordozási rátája 11-21%. A STEC O157 törzsek gyakorisága azonban 1% alatti. Az O157 törzsek a marhák béltraktusában csak igen szórványosan vannak jelen. Európában általában más pathogén szerocsoportok találhatók a marhák bélrendszerében és székletében. Ezek csökkenő gyakorisági sorrendben a következők: O26, O111, O103, O113, O128.

A pozitív állatok száma az istállóban tartott felnőtt marhák között 1,5-10 %, és sokkal alacsonyabb a borjak között. Ez a táplálkozási különbséggel magyarázható, a szoptatott állatokban ritkább, a felnőtt, kérődző, fermentációval járó táplálkozás esetén gyakoribb. A marhákon kívül  a STEC O157 Németországban előfordult birkákban, és Csehországban kecskékben.

Nem O157 STEC törzsek izolálásra kerültek birkákból, kecskékből, disznókból, macskákból, kutyákból. Nem voltak megtalálhatók szárnyasokban. Ezekből az állatokból származó STEC törzsek azonban nem tartoztak a jelentős humán pathogén szerotípusok közé. Az élelmiszer ellenőrzés Európában is a húsipari termékekre koncentrálódik, és elsősorban az O157 jelenlétének vizsgálatára. 5 országban mutatták ki darált marhahúsban ezt a baktérium törzset (Németország, Ausztria, Dánia, Olaszország, Spanyolország) és egyáltalán nem találták meg Máltán, Görögországban és Szlovéniában. Megtalálták az O157 törzset nyers tejben Ausztriában, Németországban és Olaszországban. Európában a STEC törzsek a hasmenéses betegségek 0,9%-ban voltak jelen és ezek 80%-a nem O157 szerocsoporthoz tartozott.

A Sakai járvány

A legtöbb beteget érintő EHEC járvány Japánban zajlott 1996 májusa és decembere között. Az E. coli O157:H7 okozta járvány során 9451 megbetegedés, 121 HUS és 12 haláleset fordult elő. Összesen 16 kitörésből állt. A legtöbb eset Sakai-ban, általános iskolás és óvodás gyermekek között lépett fel (9 incidens, 2470 gyermek). 1991-1995 között több mint 10 beteget érintő kitörés általános iskolákban két alkalommal, óvodákban négy alkalommal fordult elő.

1996. július 12-én este Sakai-ban általános iskolás kisgyermekeken az iskolában elfogyasztott ebédet követően véres hasmenés lépett fel. A tünetek megoszlása a hospitalizált 398 gyermekben a következő volt: hasi fájdalom 98,8%, hasmenés 96,5%, 12 napon túli hasmenés 39,5%, véres hasmenés 57%, 37 Co feletti testhőmérséklet 80,2%, hányinger 41,9%, hányás 36%. Immunomágneses szeparációval izolálták az O157:H7 törzseket és PFGE technikával igazolták az azonosságukat. A hospitalizált gyermekek közül 129-ből (32,4%) izolálták az O157:H7 E. coli törzset és 31 izolátumot vizsgáltak tovább PFGE-vel. Az izolátumok identikusnak bizonyultak.

A fertőzés közvetítője fehér retek csíra volt, amely a visszakövetés szerint egyetlen farmról származott. A retek csírákat július 5 - 7 között szállították a városba és az ebédhez felszolgált zöldségként július 8-9-10-én fogyasztották el. A fehér retek csírákat 1996 januárjában Észak-Amerikából importálták. Megvizsgáltak 11 magmintát, amit ugyanabban a periódusban importáltak az USA-ból, de nem találtak rajtuk E. coli baktériumot. A környező marhafarmokon, csatornákban szintén nem sikerült kimutatni az O157:H7 törzset. Az érintett farm a kérdéses időszakban, július 1-11 között 24,6 t fehér retek csírát szállított Japán hét prefekturájába. Szimultán kitöréseket figyeltek meg a Sakai-hoz közeli Habikino városban egy idősek otthonában. 98 megbetegedésből 6 esetben PFGE-vel identikus O157:H7 izolátum került azonosításra. Kitörést figyeltek meg Kyotoban egy vállalati centrumban (47 beteg), valamint 157 sporadikus eseményt Osaka prefekturában. Ezekből a sporadikus kitörésekből 63 O157:H7 E. coli törzset izoláltak (57 tüneteket mutató egyénből) és ezek közül 56 törzs (88,9%) PFGE mintázata azonos volt a Sakai járvány mintázatával. A járvány során epidemiológiai evidenciák, valamint kizárásos alapon feltételezték, hogy a fertőzés közvetítője fehér retek csíra volt. A nyersen felszolgált csíra bizonyult az egyetlen közös közvetítőnek a különböző területeken megfigyelt fertőzésekben.

Úgy gondolják, hogy a fehér retek csírák fertőződése a csírák növesztése során alkalmazott,  O157:H7-vel kontaminálódott öntöző vízből származott. A reservoirt azonosítani nem sikerült.

Az USA-ban az 1982-1995 közötti 75 kitörés 19%-ában szerepelt növényi eredetű fertőzést közvetítő tényező, saláta vagy almabor.

Japánban 1996-ban három további városban szerepelt saláta közvetítőként O157:H7  járványokban. (Michino H, Araki K, Minami S, Takaya S, Sakai N, Miyazaki N, Ono A, Yanagawa H. Massive Outbreak of Escherichia coli O157:H7 Infection in schoolchildren in Sakai City, Japan, associated with consumption of white radish sprouts. Amer J Epidemiol 1999 150, 787-796).

Az E. coli törzsek tipizálása

Az E. coli genetikailag heterogén baktérium törzs, általában nem patogén, része lehet az emberi és állati bél mikróba flórának, azonban néhány speciese olyan géneket akvirálhat, amelyek intestinalis vagy extraintestinalis betegséget okozhat. Az enterális betegségeket okozó E. coli törzsek különböző pathotípusokba kerültek besorolásra virulencia faktoraik és betegség okozó mechanizmusaik alapján. Az egyik pathotípus a Shiga toxint termelő E. coli, STEC vagy szinonímaként VTEC, ami a verotoxint termelő E. coli törzsek jelölése. Ezek az E. coli törzsek legalább egy Shiga toxin-szerű citotoxint termelnek. Szinonímaként használják a VT és ST EC elnevezéseket. Azokat a STEC illetve VTEC törzseket, amelyek haemorrhagias colitist és HUS-t okoznak, enterohaemorrhagias E. coli (EHEC) törzseknek nevezik. A kérődzők, főként a  szarvasmarhák a STEC törzsek jelentős rezervoirjai. Az emberi fertőzések a rezervoirból való kikerülés útján, széklettel szennyezett táplálék, vagy víz révén a marhatenyésztő telepekről kerülnek ki. A marhatenyésztés, illetve a marhahús készítés ezért a legfontosabb célterületei a fertőzések megelőzésének. Az intervenciós stratégiák célpontja az élelmiszer kontamináció csökkentése. A különböző környezetvédelmi stratégiák szempontjából kulcskérdés, hogy a pathogén STEC törzsek ürítését és a telepekről való kikerülését megakadályozzák. Több módszert ismernek az STEC törzsek karakterizálására és azoknak a tényezőknek a feltárására, amelyek a mikroorganizmusok ürítését befolyásolják. További lényeges terület azoknak a mechanizmusoknak a feltárása, amelyek révén az STEC törzsek emberi betegséget okoznak.

 STEC törzseket több féle módszerrel jellemzik. Legelterjedtebb a szerotipizálással történő klasszifikáció. Az E. coli izolátumok a következő szerotípusokkal jellemezhetők: O (német, ohne-nélkül) antigén, amely a setjfal lipopolisaccharid (LPS) részének poliszaccharid  komponense vizsgálatán alapul. A H antigén (hauch-csilló) a flagella protein változatainak jellemzésére épül. A K (kapsel) antigén besorolás a tok poliszacharidája alapján történik. 174 O antigént különböztettek meg, a számozás 1-181-ig tart. A 31, 47, 67, 72, 93, 94, 122 típusokat törölték. 53 H antigént különítettek el a nemzetközi szerotipizálási séma alapján. Az E. coli izolátumokat az O és a H antigének különböző kombinációi jelölik.

A STEC szerotípusok elég nagy százaléka non-motilis (NM) H antigén mutáns törzs. Kiegészítő vizsgálatokkal meg lehet határozni az egyes NM szerotípusokon belül a baktérium speciesek különbségeit. Példa erre az O157:NM STEC törzs, amely a gyakran előforduló O157:H7 STEC törzs mutáns változata is lehet, vagy lehet teljesen különböző O157 törzs is. A hagyományos O157:H7 STEC törzs sorbitol bontás tekintetében negatív és világszerte előfordul. Az O157:NM STEC törzs azonban sorbitol pozitív és csak Európa bizonyos részein található meg.

Sok E. coli izolátum, beleértve STEC specieseket, olyan O és H antigént, esetleg mindkettőt tartalmazhat, amelyek nincsenek benne a nemzetközi meghatározási rendszerben és ennél fogva nem szerotipizálhatók. E mellett elég limitált az E. coli szerotipizálásra akkreditált laboratóriumok száma. Ezzel együtt a szerotipizálás alapvető az STEC diagnosztikájában, ez a kezdő lépése az STEC törzsek jellemzésének. A szerotípusokat illetően az O157:H7-nek kiemelkedő jelentősége van az emberi betegségek szempontjából, ezért rendkívül fontos a kórokozó törzs STEC szerotipizálás során a lehetséges két fő kategóriába, O157 vagy nem O157 szerotípusokba történő besorolás.

A szerotípusok asszociációit vizsgálva a különböző súlyosságú emberi, sporadikus, vagy járványos betegségekkel, az a javaslat született, hogy a STEC törzseket 5 szeropathotípusba csoportosítsák, A-E-ig.

Szeropathotípus A: O157:H7 és O157:NM. A legvirulensebb törzsek tartoznak ide. A betegség asszociáció nagy frekvenciájú, a járványokban való részvétel, haemorrhagias colitissel és HUS-val való társulás gyakori.

Szeropathotípus B: O26:H11, O103:H2, O111:NM, O121:H19, O154:NM. Emberi betegség asszociációjuk közepes, járványokban való részvételük nem gyakori, haemorrhagias colitissel vagy HUS-val alkalmanként asszociálnak. A törzsek pathogenitása hasonlít az O157 STEC-hez, súlyos betegségeket és járványokat is okozhatnak, de részvételük gyakorisága az előző szeropathotípusnál ritkább.

Szeropathotípus C: O5:NM, O91:H21, O104:H21, O113:H21, O121:NM, O165:H25 és mások. Betegség asszociációjuk alacsony, járványokban való részvételük ritka. Társulhatnak HUS és haemorrhagias colitis előfordulásával. Ezek a pathotípusok ritkán okozhatnak sporadikus HUS-t, általában azonban nem okoznak járványokat.

Szeropathotípus D: O7:H4, O69:H11, O103:H25, O113:H4, O117:H7,O119:H25 ,O132:NM, O146:H21, O171:H2, O172:NM, O178:H8, és mások.

Betegségekkel való asszociációjuk alacsony, részvételük járványokban ritka, haemorrhagias colitissel vagy HUS-val nem asszociáltak. Sporadikus hasmenéses esetekben előfordulhatnak kórokozóként.

Seropathotípus E: O6:H34, O8:H19, O39:H49, O46:H38, O76:H7, O84:NM, O88:H25, O98:H25, O113:NM, O136:NM,O143:H31, O156:NM, O163:NM és mások

Nem kórokozók, járványok kitörésében nem fordultak elő kórokozóként és nem társulnak haemorrhagias colitissel vagy HUS-val. Ez a STEC szeropathotípus eddig nem okozott emberi betegséget.

Ha a virulencia gének jelenlétét pathológiai markerekként együtt értékelték a szeropathotípusokkal, a mintázat többnyire nem volt egyértelműen kapcsolható az egyes szeropathotípusokhoz. Különböző kombinációk mindegyik szerotípusban előfordultak. A szeropathotípus koncepció hasznos lehet a bakteriális kórokozók betegséget okozó képességének felderítésében, de egyéb megfontolások is szükségesek a biztos diagnosztikához. A szerotipizálás alkalmas eszköz volt az STEC törzsek bizonyos különbségeinek feltárásában.

Dániai betegekből származó 312 STEC izolátum 50 O és 75 H szerotípushoz tartozott.

A STEC törzsek szubtipizálási módszerei

Az STEC törzsek genetikai diverzitása enormis. Az O157:H7 serotípuson belül a diverzitás az O szigetekben bekövetkező inzerciók és deléciók, valamint bakteriofágok következménye. Epidemiológiai tanulmányok, járványok vizsgálata, illetve földrajzi területekhez kötött ételfertőzések tanulmányozása subtipizálási módszereken alapult. Ezek a technikák képesek különbséget tenni az adott szerotípuson belül. Ezeket a módszereket leginkább az O157:H7, EHEC tanulmányozására fejlesztették ki. Az egyik legelterjedtebben alkalmazott subtipizálási módszer a pulse-field gel elektrophoresis, PFGE. Az eljárás során a bakteriális kromoszóma DNS-ét restrikciós enzimmel történő emésztéssel 20-25 darabra vágják, amelyeket azután gél elektroforézissel szeparálnak (Gerner-Smidt P, Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, Barrett TJ. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of  Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathogens and Disease. Spring 2006, 3(1): 59-67.)

Peter Gerner-Smidt

A kép forrása: Internet

A fragmens mintázatok összehasonlítása lehetővé teszi az egyes izolátumok rokonságának megállapítását.

Genetikai különbségeket feltáró módszerek a multi-locus sequencetyping (MLST) és a repetitíve egységeket vizsgáló PCR (repetitive element PCR, polimeráz láncreakció, polymerase chain reaction), amelyek a bakteriális genom különböző területeinek génszekvenciáját vizsgálva adnak lehetőséget az összehasonlításra.

Az említett genetikai elemző módszerek közül a PFGE bizonyult diszkriminatív képesség szempontjából a legeredményesebbnek. 92 O 157:H7 izolátumból 72 eltérő profilt sikerült detektálni PFGE-vel, mindössze 14-et repetitíve elementum PCR-vel, MLST-vel pedig csak ötöt. Standardizációs protokoll alapján a DNS emésztés XbaI (Xanthomonas badrii)enzimmel javasolt, így az összehasonlítás a PulseNet hálózaton a különböző országok eseteinél is lehetséges. A PFGE diszkriminációs képessége egy második enzimmel, BlnI (Brevibacterium linens) emésztéssel való kiegészítés révén növelhető. A PFGE technika rendkívül hasznosnak bizonyult a fertőző forrásokból származó egyes izolátumok azonosításában, legyenek ezek tápanyagok, állatok vagy betegek.

Ezzel a technikával vált lehetővé olyan járványok felfedése, amelyek amúgy észrevétlenek maradtak volna. Az analízisek azt mutatják, hogy 67 %-val növekedett a járványok detektálhatóságának szenzitivitása.

PFGE technikával igazolták, hogy a dániai STEC infekciók legnagyobb része sporadikus infekció volt.

A PCR alapú multiple locus variable-number tandem repeat (VNTR) analysis technika a változó számú tandem duplikációs szakaszok hosszát értékeli. Ez a subtipizálási módszer a PFGE-hez hasonló szenzitivitású és specifitása felülmúlja azt.

A multilokusz szekvencia tipizálás (MLST) az ún. house keeping gének nukleotid szekvencia variánsait vizsgálja. Az eredeti analízis 7 gént valamint 2 membrán proteint, az OmpA-t és az EspA-t vizsgálta. Az O157:H7 STEC törzs 77 izolátumát elemezve a módszer nem tárt fel diverzitást.

Az adk, fumC, gylB, icd, mdh, purA és recA gének fragmentumainak (adk-adenylate kinase, fumC-fumarat hydratase, fumarase, gyrB-gyraseB, icd-isocitrate dehydrogenase, mdh-malate dehidrogenase, purA-adenylo succniate synthetase, recA-recombinaseA) amplifikációja és szekvencia analízise alapján az E. coli fajok rokonsága megállapítható az MLST adatbázisával (Multi Locus Sequence Typing) összevetéssel(http://mlst.ucc.ie/mlst/dbs/Ecoli/.a).  A módszer felhaszálható az egyes coli törzsek rokonságának kiderítésére az eBuRST (based upon related sequence types version 3 http://eburst.mlst.net/) és a Clonal Frame (version 1.1 http://www.xavierdidelot.xtreemhost.com/clonalframe.htm) programok alkalmazásával.

Az egyes komplexek kialakításának szekvencia alapját hat identikus allél jelenléte adja meg egy 1000-es mintában.

A fenti módszerrel a nigériai gyerekek hasmenéses székletmintáiban  3344 E. coli izolátumot tipizáltak és azt figyelték meg, hogy ezek 1985 szekvencia típushoz tartoznak és a BURST algoritmus alkalmazásával 103 komplexbe sorolhatók a hat alléles definíció alapján.

Ezen belül a HEp-2 sejtekhez történő adherencia tesztben pozitív, enteroaggregatív E. coli törzsek közül 96-ot identifikáltak. Az összes EAEC törzs 16 szekvencia típus komplexbe volt sorolható, 40%-ban pedig három fő csoportba (Okeke I.N., Wallace-Gadsden F., Simons R., Matthews N., Labar A.S., Hwang J., Wain J. Multi-locus sequence typing of enteroaggregativ Escherichia coli isolates from Nigerian children uncovers multiple lineages.  J Plos One 5, 1-12, 2010)

1987-től Ahmed és mtsai fágtipizálási rendszert fejlesztettek ki (Ahmed R, Bopp C, Borczyk A, Kasatiya S. Phage-typing scheme for Escherichia coli O157:H7. J Inf Dis, 1987, 155, 4, 806-809).  A fágtípusok száma az eredeti 62-ről 88-ra nőtt. Ez a módszer hasznos kiegészítője a PFGE analízisnek.

Ugyancsak hasznos kiegészítő a virulencia gének jelenléte alapján történő STEC subtipizálás.

Ebben a vizsgálati panelben a Shiga toxin gének (STX), az E. coli attaching and effacing (tapadási és csupaszítási gének, EAE) gének és az EHEC haemolysin gének (EHLY/EHXA) kerülnek vizsgálatra. Az STX és a fág szubtipizálások alapján a dán, súlyos megbetegedéseket okozó O157:H7 STEC törzsek vizsgálata azt mutatta (63 szarvasmarha és 86 humán izolátum), hogy az STX2 pozitív izolátumok okozták a súlyos humán betegséget, és ezek a törzsek a szarvasmarha izolátumoknak csak igen kis százalékát tették ki. Úgy látszik, hogy a marhákból származó O157:H7 törzseknek csak igen kis része okoz humán megbetegedést.

A STEC több mint 435 serotípusát mutatták ki a szarvasmarhák ürülékében. Emberből több mint 470 serotípust izoláltak. A legtöbbjüket megtalálták a szarvasmarhákban, a marhahúsban vagy mindkettőben. Észak-Amerikában a marhák, Ausztráliában a birkák a STEC legnagyobb rezervoirjai. A különböző országok lábasjószág állományában, illetve az egyes csordákban a prevalencia arány 0-100%. A legalacsonyabb a prevalencia arány a fehér borjúban, 0-9,9 %. Az O157:H7 STEC szerotípusok ürítését befolyásolja a szoptatás és a marhák kora. Meleg hónapokban az ürítés nagyobb mértékű, mint a hideg hónapokban. Az ürülékben 4-10 millió CFU/g (colony forming unit) mennyiség ürülhet, általában 10 és 100 CFU/g között van az ürített baktériumok mennyisége. A baktériumok ürítése nem folyamatos. Nem találtak különbséget a legelőn, vagy a tenyésztelepen táplált marhák ürítése között. Az állatok egy része magas koncentrációban üríti az O157:H7 STEC-ket néhány héten át, ezeket perzisztáló ürítőknek nevezik. Ezekben az állatokban az STEC a rectum terminális területén colonizálódott. Matematikai modellezéssel megállapították, hogy az állatok között szuper ürítők is jelen vannak. A vágóhídi marhák rectális faecesét vizsgálva kimutatták, hogy 10000 CFU/g feletti mennyiségű mikroorganizmust az állatok 9%-a, más vizsgálatokban 3,7%-a ürített. Az ürítés időtartama változó, de általában rövid. Az O157:H7 STEC törzseket 1-10 hétig, az O26 STEC-t 1-3 hétig ürítették az állatok. Úgy gondolják, hogy az O157:H7 STEC-t az állatok hosszabb ideig és nagyobb koncentrációban ürítik, mint a nem O157 STEC-ket. Amerikai tanulmányban különbséget találtak az O157 STEC minták előfordulási gyakoriságában az erjesztett magvakkal táplált marhákban, ahol hatszor gyakoribb volt a STEC előfordulás. Geográfiailag is különbség mutattkozott az ürítés mértékében. Nebraskaban kilencszer gyakoribb volt a kórokozó ürítés, mint Kelet Coloradóban.

Birkákból több mint 100 STEC szerotípust izoláltak.

A STEC szerotípusokat hordozó sertések között rendszeresen előfordul az ún. oedema- betegség. Ez a fajra specifikus megbetegedés. 30-40%-os morbiditású, 90%-os mortalitású, STX2e által okozott, vaszkuláris léziók következtében kialakuló gastrointestinális és idegrendszeri tünetekkel, a szemek körül, a homlokon, submandibularisan, a gyomor bélrendszerben oedema képződéssel, megelőzően hasmenéssel, étvágytalansággal, ataxiával járó kórkép. A sertések között gyakori az O157:nem H7 törzsek  és az STX negatív törzsek hordozása (Post KW, Bosworth BT, Knoth JL. Frequency of virulence factors in Escherichia coli isolated from pigs with postweaning diarrhoe and edema disease in North Carolina. Swine Health and Production 2000, 8, 119-120)

A sertések oedema betegsége (stx2e típusú toxin, Gb4 receptor).

A képek forrása: Internet

A STEC törzsek okozta emberi betegségek

Mintegy 500 STEC szerotípust izoláltak humán megbetegedésekből. Ezek többségéért kevesebb, mint 10 O szerocsoportba tartozó coli törzs volt felelős. Az országok többségében az O157:H7 szerotípus okozza a legtöbb betegséget és járványt. Dániában a  STEC infekciók 26%-ában, Argentinában 60%-ban, USA-ban 30%-ban az O157:H7 volt a kórokozó.  A nem O 157 szerocsoportok és a szerotípusok gyakorisága országról országra változik, a leggyakoribbak az O26, O103, O111, O145.

Az STEC-vel történő fertőződés

Az ember a STEC-vel kontaminált élelmiszer, víz fogyasztása útján, vagy állatokkal történő direkt kontaktus során fertőződik. Előfordulnak sporadikus esetek, és járványos kitörések, akár több ezer ember érintettségével. A fertőzés forrása lehet hús (USA-ban gyakran nem kellően megsütött marhahúsból készült hamburger), konyhatechnikai előkészítő eljárást nem igénylő, étkezésre kész kolbászfélék, nyers tej, sajtok, nem pasztörizált, almából készült üdítőitalok (almabor, almajuice), saláta, sárgadinnye, lucernahajtás, retekhajtás, ivóvíz, fürdővíz, állatkontaktus. Észak-Amerikában és az Egyesült Királyságban az O157:H7 fertőzés fő forrása a sületlen hamburger volt. A kontinentális Európában ez nem fordult elő. A kórokozó transzmissziója történhet emberről-emberre. Az O157:H7 fertőzést okozó baktérium csíraszám dózisa alacsony, általában 50- néhány 100 kórokozó jut a szervezetbe.

A STEC emberben a következő tüneteket, betegségeket okozhatja:

-         nem okoz betegséget

-         vizes hasmenés

-         véres hasmenés

-         HUS- acut veseelégtelenség, microagniopathias haemolyticus anaemia thromocytopaenia, elsősorban a vese az érintett szerv, de több szerv érintettsége is előfordul, igy a központi idegrendszeré, tüdőé, hasnyálmirigyé és a szívé. HUS az O157:H7 STEC törzzsel fertőzött emberek 5-10 %-ban alakul ki. 5 évnél fiatalabb gyermekek és idősek a szövődményekre érzékenyebbek.

A németországi E. coli O104:H4 járvány

(Bielaszewska M, Mellmann A, Zhang W, Köck R, Fruth A, Bauwens A, Peters G, Karch H.

Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study.The Lancet 2011,

www.thelancet.com/infection Published online June 23, 2011 DOI:10.1016/S1473-3099(11)70165-7.

Mellmann A, Harmsen D, Cummings DA, Zentz EB, Leopold SR, Rico A, Prior K,  Szczepanowski R, Ji Y, Zhang W, McLaughlin SF, Henkhaus JK, Leopold B, Bielaszewska M, Prager R, Brzoska PM, Moore RL, Guenther S, Rothberg JM, Karch H. Prospective genomic characterization of the German enterohemorrhagic Escherichia coli O104:H4 outbreak by rapid next generation sequencing technology.PLoS ONE 2011, 6 (7): e22751. doi:10.1371/journal.pone.0022751.

Frank C, Werber D, Cramer JP, Askar M, Faber M, an der Heiden M, Bernard H, Fruth A, Prager R, Spode A, Wadl M, Zoufaly A, Jordan S, Stark K, Krause G for the HUS Investigation Team. Epidemic profile of Shiga-toxin–producing Escherichia coli O104:H4 outbreak in Germany — preliminary reportNEJM 2011. 10.1056/nejmoa1106483 nejm.org.

Rohde H, Qin J, Cui Y, Li D, Loman NJ, Hentschke M, Chen W, Pu F, Peng Y, Li J, Xi F, Li S, Li Y, Zhang Z, Yang X, Zhao M, Wang P, Guan Y, Cen Z, Zhao X, Christner M, Kobbe R, Loos S, Oh J, Yang L, Danchin A, Gao GF, Song Y, Li Y,Yang H, Wang J, Xu J, Pallen MJ, Wang J, Aepfelbacher M, Yang R and the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium. Open-source genomic analysis of Shiga-toxin–producing E. coli O104:H4.  NEJM 2011. 10.1056/nejmoa1107643 nejm.org,

Rasko DA, Webster DR, Sahl JW, Bashir A, Boisen N, Scheutz F, Paxinos EE, Sebra R, Chin C-S, Iliopoulos D, Klammer A, Peluso P, Lee L, Kislyuk AO, Bullard J, Kasarskis A, Wang S, Eid J, Rank D, Redman JC, Steyert SR, Frimodt-Møller J, Struve C, Petersen AM,  Krogfelt KA, Nataro JP, Schadt EE, Waldor MK. Origins of the E. coli strain causing an outbreak of hemolytic–uremic syndrome in Germany.  NEJM 2011. 10.1056/nejmoa1106920 nejm.org. közlemények alapján)

Az összefoglaló elkészítéséig a német járványból származó 7 Escherichia coli izolátum szekvencia analízisét publikálták folyóiratokban.  A TY2482 (Rohde H et al. New England J Med, NEJM, 2011), és a H11218280 vizsgálatát a BGI (Beijing Genomics Institute), a genom összeállítását Nick Loman, Health Protection Agency, HPA, UK készítette el, az LB22692, LB226543, LB226755 és LB226806 törzsekét A Melmann, M. Bielaszewska és mtsai  (University Münster, Lancet online June 23, 2011, J PLOS ONE, 6, e22751, 2011) végezték el, a C227-11 koppenhágai izolátumét DA Rasko és mtsai (NEJM, 2011) közölték.

Az izolátumok génszekvenciája egymáshoz nagyfokban hasonlónak bizonyult. A különbségek a plazmidok jelenlétéből, illetve az alkalmazott technikák különbségéből adódtak. A TY282, a H11218280, az LB22692, LB226543, LB226755 és LB226806 analízise Life Technologies Ion Torrent szekvencia analízissel történt, a C227-11 isolátum vizsgálata PacBio-RS Sequencerrel (real time single molecule long read sequencer, PACIFIC BIOSCIENCES OF CALIFORNIA INC). A törzs genetikai anlízisét végző szerzőcsoportok elképzeléseit a törzs evolúciójáról a közleményeik alapján részletezzük.

Az NCBI adatbázisában jelenleg 24 O104:H4 E. coli törzs szekvencia adatai szerepelnek. A közleményben publikáltakon kívül szekvencia analíziseket végzett a Broad Institute (11-4404, 11-4522, 11-4623, 11-4632 C1, C2, C3, C4, C5, C227-11 – ez a törzs azonos DA Rasko és mtsai PacBio törzsével, C236-11, Ec11-5536, -5537, -5538 törzsek), a Goettingen Genomics Laboratory (GOS1 és GOS2), a Health Protection Agency (H112180280- azonos a BGI által is szekvenált egyik törzzsel, H112180282, H112180283, H112180540, H112080541, a HPA a szekvencia analízist piroszekvenálási eljárással végezte, 454 GS Junior, Roche Diagnostics, automata szekvenáló rendszerrel, seqProject/HealthProtectionAgencyUK/annotations/era7 bioinformatics/era7_HPA_ H112180280_annotations).

A különböző real time szekvenálási eljárások lehetővé tették az élővilág genomjainak igen rövid idő alatt történő szekvencia analízisét. A Beijing Genomics Institute és a Münsteri Egyetem Közegészségtani Intézete az Ion Torrent Systems Inc. által kifejlesztett ion félvezető szekvenálási technikával gyakorlatilag három nap alatt (ugyanaznap, június 2-án néhány óra különbséggel) elvégezte a németországi E. coli baktérium törzs génszekvencia analízisét. A félvezető alapú szekvenálási módszer a szekvenálással történő szintézisen alapul. A rendszer a DNS polimerizáció alatt felszabaduló hidrogén ionokat detektálják. Szemben a korábbi, modifikált nucleotidokat és optikai detektálást alkalmazó rendszerekkel, ez egy pH-mediált, szilikon szekvenálási eljárással működő készülék, amelyet 2010-ben kezdtek forgalmazni. A mikrovájulatok tartalmazzák a szekvenálandó templát DNS szálakat és a nukleotidokat. Amikor a komplementer szálba a soron következő nukleotid beépül, a felszabaduló hidrogén ion jelenlétét egy hiperszenzitív ion szenzor detektálja. A hidrogén ion felszabadulás azt jelzi, hogy a reakció megtörtént. Ha homopolimer ismétlődések vannak jelen a templát szálban, akkor több azonos nukleotid épül be és ez nagyobb számú hidrogén ion felszabadulást okoz, amely arányosan magasabb elektronikus szignált vált ki. A félvezető chip mikrovájulatainak mindegyike tartalmaz egy egyszálú templát DNS molekulát, és egy DNS polimeráz enzimet. A vájulatokba szekvenciálisan hozzáadott, nem módosított A, C, G vagy T dNTP nucleotidokat  helyeznek. Ha a dNTP beépül a komplementer szálba, a felszabaduló hidrogén ion megváltoztatja az oldat pH-ját és ezt a hiperszenzitív ion szenzor érzékeli. Ha nem történik beépülés, nem keletkezik jel. A mikrovájulat alatt ionérzékelő réteg található, amely hiperszenzitív ISFET ionszenzor  (Ion-selective field effect transistor). Valamennyi réteg a CMOS (complementary metal–oxide–semiconductor, integrált áramkörök készítésének technologiája) félvezető chip része, hasonlóan az elektronikus iparban használtakhoz. Az elektronikus impulzusokat a chipről számítógépbe juttatják, amelyben a jelsorozatok DNS szekvenciákká alakítódnak. Minden chip egy mikrovájulat sort tartalmaz. A leolvasott bázissorrend pontosság 50 bázis leolvasási méretnél 99,6%-os. A leolvasási hosszúság 2011 elején 100 bázisnyi volt. Homopolimer ismétlődések esetén a pontosság 5 ismétlődésnyi hosszúság esetén 98%-os volt. A félvezető szekvenálási technika előnye, hogy igen gyors és az operációs költsége alacsony. Az Ion Torrent System Inc szerint minden beépülés 4 másodpercet vesz igénybe és minden futtatási ciklus kb. egy órát igényel, amely alatt 100-200 nukleotid szekvenálható. A készülék ára a piacra kerüléskor 50 000 USD volt. A Wikipedia alapján lészített összeállítás tartalmazza a real time szekvenálási eljárások legfontosabb adatait. Ebből az látszik, hogy az ion torrent eljárás költsége alacsonyabb, mint a táblázatban szereplő másik három eljárásé (piroszekvenálás, illumina, és szolid szekvenálási eljárások, Ion semiconductor sequencing, en.wikipedia.org). Az eljárás hátrányának tartják, hogy a hosszú homopolimer ismétlődések esetén az ismétlődések számának értékelése nehéz, ami hibalehetőséget hordozhat. Az alternatív real time szekvenálási metódusok közül a hosszabb leolvasási távolsággal működő készülékek alkalmasabbak lehetnek nagyméretű teljes genomok analízisre, viszont a kisebb méretű, mikrobiális genomok szekvenálására ez az eljárás előnyösebben alkalmazható a gyorsasága miatt.

A harmadik generációs szekvenálási eljárások jellemzői (Ion semiconductor sequencing, en.wikipedia.org  alapján)

 

Ion Torrent

454 Sequencing

Illumina

SOLiD

módszerek

Ion félvezető szekvenálás

Piroszekvenálás

Polimeráz akapú szekvenálás szintézissel

Ligálás alapú szekvenálás

futtatási ciklusonként elemezhető Mb szám

100 Mb

100 Mb

600 Gb

3000 Mb

egy ciklus időtartama

2 óra

7 óra

9 nap

5 nap

leolvasásható hosszúság

100 bp

400 bp

2x100 bp

35-50 bp

futtatásonkénti költség

$ 500 USD

$ 8,438 USD

$ 20,000 USD

$ 17,447 USD

egy megabázisnyi költség

$ 5.00 USD

$ 84.39 USD

$ 0.03 USD

$ 5.81 USD

az eszközök piaci ára

$ 50,000 USD

$ 500,000 USD

$ 600,000 USD

$ 591,000 USD

 

A németországi járványt okozó törzs molekuláris jellemzését Martina Bielaszewska és mtsai, a Münsteri Egyetem Közegészségügyi Intézetének és az ugyanitt működő Nemzeti Hemolitikus Urémiás Szindróma Laboratórium kutatói közölték elsőként a Lancet hasábjain június 22-án (Bielasewska M. és mtsai Lancet Infect. Dis. 2011, june 22 E PUB, www. thelancet.com/infection online june 22 2011 DOI:10.1016/s1473-3099(11)70165-7, Kupferschmidt K Science 2011, 332, 1249-1250).

Május 23 és június 2 között kialakult 80 eset széklet mintáit vizsgálták az általuk kidolgozott multiplex PCR technikával különböző virulencia gének előfordulásának kimutatására. Szekvenálták a stx gént, vizsgálták az epithél sejtekhez történő adherenciát, a törzsek antibiotikum érzékenységét. Mind a 80 izolátum O104:H4 Shiga toxint termelő törzsnek bizonyult. MLST vizsgálattal a törzsek az ST (sequence type) 678-hoz tartoztak. Az MLST analízisben 7 ún. house keeping gén (háztartási gének, az alapvető sejtfunkciókat végző, valamennyi sejtben konstitutívan expresszálódó gének) fragmentjének vizsgálata szerepelt. Ezek a következők: adk-adenylate kinase, fumC-fumarat hydratase, fumarase, gyrB-gyraseB, icd-isocitrate dehydrogenase, mdh-malate dehidrogenase, purA-adenylo-succniate synthetase (purin és adenin), recA-recombinaseA. E mellett parciális gnd (677bp terület, gluconate-P dehydrogenase) egyidejű analízise is történt. A fenti gének vizsgálatával az izolátumok biztosan azonosíthatók voltak. A törzsek nagyfokú hasonlóságot mutattak a HUSEC041, ún. történelmi törzzsel, amelyet 2001-ben egy németországi HUS-s esetből izoláltak. Ez a törzs is O104:H4 szerotípusú volt. Ezen kívűl a világon még egy O104:H4 STX termelő törzset írtak le, egy Koreában fellépett HUS eset kapcsán. A szerzők által kifejlesztett multiplex PCR reakció négy virulenca gén előfordulását detektálta egyidejűleg, az stx2 584bp, a terD (tellurit rezisztencia gén) 434 bp, az rfb O104 (mannóz homopolimer O antigén gén cluster, az O104 törzsre jellemző LPS szerkezet génje) 351 bp, és a fliC H4 (flagellar filamet structural protein, flagellin), 201 bp méretű fragmentumait. A szerzők analízise szerint mind a jelenlegi, járványt okozó O104:H4 törzsben, mind a 2001-es HUSEC O41 izolátumokban jelen vannak a következő virulencia faktorok: STX2, IHA (IrgA homologue adhesin, irg-iron regulated A), lpfA O26 (long polar fimbriae strukturális alegység, STEC O26-ban került leírásra), lpfA O113 (lpf strukturális alegység, a STEC O113-ban került leírásra), a ter cluster (tellurite resistance cluster), irp2 (a hpi, high pathogenicity island, vasfelvételi rendszer komponense, iron regulated protein 2), az fyuA (a hpi vasfelvételi rendszer komponense, ferric yersiniabactin uptake A), az aatA (EAEC pAA virulencia plazmidja), aggA (az aggregative adherence fimbriae I pilin alegység, az AAF/1), az aggR (aggregativ adherencia fimbria transzkripcionális regulator), az aap (dispersin), a set1 (shigella enterotoxin 1) és a pic (protein involved in intestinal colonisation). A különbség a jelenlegi járványt okozó O104:H4 törzs és a történelmi HUSEC O41 (2001-es törzs) között az, hogy a 2001-es törzs adherencia fimbriája AAF3 (agg3/A gén), a jelenlegié pedig AAF/1 (aggA gén). A szerzők elemezték az EAEC 55989 törzs virulencia faktoraival való azonosságokat és különbségeket. Mind a jelenlegi járványt okozó, mind a történelmi HUSECO41 törzsek EAEC 55989-vel közös virulencia faktorai a következők: iha, IpfAO26, IpfAO113, aatA (autotransporter adhesin of avian pathogenic Escherichia coli, adhesin autotransporter), aggR, aap (dispersin gén), set1, pic. A történelmi HUSEC O41 és az EAEC 55989 olyan közös virulencia faktor génjei, amelyek nincsenek jelen a jelenlegi törzsben, a következők: agg3/A, astA (EAEC heat-stable enterotoxin 1, EAST1).

A törzsek tenyésztett intestinalis epithel sejtekhez történő adherenciája a jellegzetes téglarakás képet (EAEC) mutatta. Valamennyi vizsgált izolátum által termelt stx2 nagyfokú Vero sejt cytotoxicitással rendelkezett. A járványból származó törzsek ESBL fenotípusúak voltak. A szerzők kiemelik, hogy a székletminták megérkezése után két napon belül, a fliC RFLP (H4 antigén molekuláris azonosítása) és az MLST vizsgálatok segítségével megtörtént az O104:H4 törzsek azonosítása.

A New England J Medicine (NEJM) 2011. június 22-én közölt összefoglalást a németországi STX termelő E. coli O140:H4 járványról és 2011. július 29-én pedig a törzs eredetéről.

Május 19-én a németországi Robert Koch Közegészségtani Intézet tájékoztatott három, gyermekeket érintő HUS eset előfordulásáról. A három beteg ugyanaznap került felvételre a Hamburgi Egyetemi Kórházba. A Robert Kock Intézet vizsgáló team-je május 20-án érkezett Hamburgba a közegészségügyi vizsgálat elvégzésére. Szinte azonnal nyilvánvalóvá vált, hogy az esetek száma emelkedik, és felnőttek között is előfordulnak megbetegedések. Kiderült, hogy Észak-Németország területén más régiókban is észleltek megbetegedéseket. Vizsgálatok kezdődtek a közegészségtan több területén. Az élelmiszer biztonsági hatóságok elkezdték a kórokozó ágens azonosítására irányuló vizsgálataikat, valamint a közvetítő út felderítését, továbbá intézkedéseket hoztak a további megbetegedések megelőzésére. A HUS-t gyermekekben 1955-ben Gasser C és mtsai publikálták a Schweiz Med Wochenschr hasábjain (Gasser C, Gautier E, Steck A, Siebenmann R E, Oechslin R. Hämolytisch-uramische Syndrome: bilaterale Nierenrindennekrosen bei akuten erworbenen hämolytischen Anamien. Schweiz med Wschr 1955, 85, 905-909). A kórállapotot hemolitikus urémiás szindrómaként írták le. A jellemzők akut, kétoldali vesekéreg nekrózis, akut veseelégtelenség, hemolitikus anémia és thrombocytopénia voltak. A hasmenéssel társuló HUS korábban elsősorban gyermekekben fordult elő, főként a Shiga toxint termelő E. coli O157:H7 szerotípus által okozott infekciókban. A baktériumok rezervoirja rendszerint a kérődzők, elsősorban szarvasmarhák bélrendszere volt. Az emberi Shiga toxint termelő E. coli fertőzések széklettel szennyezett anyagok fogyasztása révén kerülnek az emberi bélrendszerbe, általában kontaminált élelemiszer, víz, alkalmanként állatokkal való kontaktus révén, vagy állattenyésztő telepeken, vagy megfertőződött emberekkel történő kontaktussal. Ezzel szemben HUS prodromalis hasmenéssel a felnőttekben ritka. 1989-2006 között az oklahomai TTP (thromboticus thrombocytopenias purpura) és HUS regiszterben szereplő 322 felnőtt egyén közül mindössze 21 (7%) esetében fordult elő megelőzően véres hasmenés.

A NEJM cikk áttekinti a szokatlan kórokozó által okozott járványt, a német suveillance rendszert, a klinikai és mikrobiológiai adatokat.

A jelenlegi német surveillance rendszer alapját a 2001 óta hatályban lévő, a németországi fertőzésekkel kapcsolatos törvény rendelkezése szerinti eljárás képezi. A Shiga toxin kimutatása az E. coli izolátumokban kötelezően bejelentendő. Ez a bejelentési kötelezettség lehetővé teszi a Shiga toxint termelő E. coli törzsek azonosítását, függetlenül a szerocsoportoktól. A Shiga toxint termelő E. coli gastroenteritis esetdefiníciója (HUS nélkül) a laboratóriumi vizsgálati bizonyítékokon kívül a következő tünetek valamenyikének meglétén alapul: hasmenés, három vagy több laza széklet 24 órán belül, hasi görcsök, hányás. Ezen kívül az orvosoknak is bejelentési kötelezettsége van a hasmenéssel társult HUS szindrómával jelentkező betegek esetében. A német HUS szindróma definíció tartalmazza a thrombocytopaenia (thrc) meglétét (kisebb, mint 150 000 köbmm-kénti thrombocyta szám), hemolitikus anaemia és akut veseelégtelenség tüneteinek jelenlétét. Az utóbbi három kritérium közül egy megléte esetén valószínűsítendő: emelkedett szérum kreatinin szint (értékhatár nincs megadva), oliguria, anuria, proteinuria, vagy hematuria.

A HUS eseteket a járvány kapcsán a helyi egészségügyi hatóságok regisztrálták, és elektronikusan, azonosító adatok nélkül tovább küldték szövettségi szintre. Május 23-án a Robert Koch Intézet a helyi vizsgálatokból eredő esetleges késedelem elkerülésére minden egészségügyi intézményt felszólított, hogy már klinikai gyanú esetén is azonnal tájékoztassák a hatóságokat.

A betegség kezdetének a hasmenés fellépését tekintették, függetlenül attól, hogy a HUS milyen későn alakult ki. Járványos esetnek a HUS eseteket, a Shiga toxint termelő E. coli törzs O104 szerocsoportja által okozott gastroenteritist, valamint 2011 május 1-től ismeretlen szerocsoportú E. coli törzs által okozott hasmenést tartották. Az összefoglaló 2011. június 18-tól a Német Nemzeti Adatbázisban rendelkezésre álló adatok alapján foglalja össze a járvány klinikumát. Az előzetes analízisek elsősorban a HUS esetekre, mint a járvány legfontosabb indikátorára szorítkoztak. Számos, Németországban előforduló eset kapcsolatban volt utazással, és ezért a közölt térképek az érintett betegek lakhelyével kapcsolatban félrevezetőek. A NEJM cikk térképén két éttermi cluster (3-30/100000) is szerepel. Ezek mellett ugyanilyen nagymértékű incidencia volt megfigyelhető Hamburg és Bréma környékén, Schleswig-Holsteinben és Mecklenburg-Pomeránia tartományban. A klinikai adatok a Hamburg University Medical Center betegeinek két időszakban, a korai észlelési periódusban május 19 - június 1 között, illetve egy későbbi, május 25 - júnis 6 közötti időszakban az STX pozitív betegek észlelésén alapultak.  A Shiga toxint a tenyészetekben kereskedelmi forgalomban kapható ImmunAssay-vel vagy PCR-vel detektálták, privát mikrobiológiai laboratóriumokban. A Salmonella és más enterális pathogenek kimutatására szolgáló Nemzeti Referencia Centrum erősítette meg az E. coli izolátumok Shiga toxin termelését és jellemezte a törzseket. Chromogén agar médium szolgált az ESBL pozitív enterobacteriaceae törzsek izolálására. A biokémiai jellemzés keresekedemi forgalomban lévő tesztekkel (VITEC Biomérieux Microplate GN, Biolog, API) történt. Az STX termelőnek bizonyult E. coli törzsek virulencia faktor génjeit (STX1, STX2, eae, eax) PCR technikával mutatták ki. Az enteroaggregatív E. coli törzsek virulencia faktorait, az aatA, aggR, aap, aggA, aggC géneket szintén PCR technikával azonosították. A törzsek antimikrobiális érzékenységét mikrodiluciós technikával, a minimális gátló koncentráció megállapításával (MIC, minimal inhibitory concentration) végezték az EC antimicrobial susceptibility testing guideline alapján. Az STX termelő E. coli törzsek szerotipizálása ismert standard protokoll alapján történt (Prager R, Strutz U, Fruth A, Tschäpe H. Subtyping of pathogenic Escherichia coli strains using flagellar (H)-antigens: serotyping versus fliC polymorphisms. Int J Med Microbiol 2003, 292, 477-486).

Az O104:H4 izolátumok elemzését egy restrikciós enzim használatával (Xba1), pulse-field gél elektroforezissel is elvégezték. A járvány során egy rövidített protokollt alkalmaztak a járványt okozó törzs azonosítására, a Nemzeti Referencia Centrum, a Hamburgi Egyetem és a Nemzeti HUS Laboratórium konszenzusa alapján. Az első NEJM összefoglaló 2011. május 1. és június 18. között keletkezett klinikai adatok alapján készült, összesen 810 HUS esetet, köztük 27 halállal végződöttet (3,3%) tartalmazott, valamint további 2412 németországi STX termelő E. coli gastroenteritises esetet. Ezek mindegyike laboratóriumi vizsgálatokkal megerősített eset volt és ezek közül halállal további 12 eset végződött (0,5%).

A HUS szindróma előfordulásának gyakorisága a járvány során 25,1%-os volt. Május 1-8 között alacsony számban fordultak elő a STEC gastroenteritisek, a férfiak és a nők körében még hasonló gyakorisággal. Május 8. után drámaian nőtt a hasmenéses és a HUS esetek száma. Az első HUS esetek május 9-től jelentkeztek. A járvány május 21-22-én tetőzött. Ebben az időszakban már jelentősen gyakoribb volt mind a HUS előfordulás, mind a gastroenteritis a nők között (nő/ffi: 2/3-1/3). Június 10. után HUS eseteket már nem regisztráltak.

HUS eseteket Németországban 16 tartományból jelentettek, a legnagyobb incidencia az északi tartományokban volt, Hamburg környékén (incidencia 10,1/100000), ezt követte Schleswig Holstein (6,7/100000), Bréma (2,7/100000), Meklenburg-Pomeránia (2,2/100000) és Alsó-Szászország (1,7/100000). Ez volt az ún. Észak-német járvány övezet. A járvány ezeken a területeken egyidőben lépett fel. A többi érintett tartományban a járványok megjelenése utazással állt összefüggésben. A két étteremmel összefüggő satellita cluster Észak-Rajna Vesztfáliában és Dél-Hessenben alakult ki.

A HUS szindrómában megbetegedettek 89%-a 17 év feletti felnőtt volt. A 17 éven aluliak életkori középértéke 11.5 év volt. Csak az érintett HUS esetek 1%-a volt 5 évnél fiatalabb. Ez az életkor az, amely a Németországban korábban, 2001-2010 között előfordult HUS esetek életkori középértéke. A HUS esetekben szenvedők életkori középértéke ebben a járványban 43 év volt, nők esetében 44 év, férfiak esetében 41 év. A Hambrug környéki HUS esetek medián életkora szignifikánsan alacsonyabb, 34 év volt, mint a környező vidéken megbetegedetteké. A HUS syndromában elhunyt betegek medián életkora 74 év volt, az életkori tartományuk pedig 24-91 év.  Hasonlóan az STX termelő E. coli gastroenteritisben elhunytak medián életkora 83 év, a tartomány 38-89 év volt. A HUS incidenciája a járvány során a nőkben a 30-34 éves korcsoportban tetőzött, férfiak esetében pedig 25-29 év között. A HUS szindrómában szenvedő betegek 68%-a, a gastroenteritisben megbetegedettek 58.8%-a volt nő. A két csoportban meghaltak között pedig a HUS-ban elhunytak 77,8%-a, a gastroenteritisben elhunytak 58,3%-a volt nő. A járvány lefolyása során a férfiak aránya növekedett, a májusban megbetegedettek 31,9 %-a, júniusban pedig 47,8%-a volt férfi. A HUS szindrómában szenvedők között az öt legészakibb tartományban a nők aránya még nagyobb volt, Hambrugban pl. 74,3%. A medián inkubációs idő a Német járványban 8 nap volt. Nem volt érdemi különbség a csak gastroenteritises, illetve a HUS esetek inkubációs ideje között. A hasmenés kezdete és a HUS szindróma diagnózisa közötti medián időintervallum 5 nap volt. Az első periódusban a megbetegedettek 88%-a felnőtt volt, ezek 66%-a nő, a gyerekek között azonban 50% volt lány. Egy betegnek sem volt láza (definició: hőmérséklet nagyobb, mint 37,5 oC). Véres hasmenés a gyermekek között kevésbé gyakran fordult elő, mint a felnőttek között (59%-vs. 96%, szignifikáns különbség). A hasi fájdalom mind a gyermekek, mind a felnőttek esetében a leggyakoribb tünet volt (92-vs. 89%). Hányás signifikánsan gyakrabban fordult elő gyermekekben, mint felnőttekben (59%-vs. 20%). A betegekben általában nem volt jelentős fehérvérsejtszám (13000/mm3 alatti érték) vagy CRP emelkedés (15-35 mg/l). A kezdeti időszakban 141 betegből 22 (16%) betegnél alakult ki HUS. A prospektíven követett 135 betegből STX termelő E. coli törzset 59-ben (44%) sikerült kimutatni és ezek közül 12-ben (20%) fejlődött ki HUS. A HUS kialakulása általában hirtelen következett be. A HUS snydromában a betegek Hgb (haemoglobin), leukocyta, thrombocyta száma alacsonyabb, a kreatinin, LDH (lactate dehydrogenase), bilirubin és CRP (C reaktív protein) szintje pedig magasabb volt. A csak STX E. coli gastroenteritisben szenvedő gyerekekben  a CRP szint a felnőttekéhez képest magasabb (46 microgramm/mililiter) volt és HUS fellépése esetén az LDH szint igen magasra (1835 U/l, unit, egység/liter) emelkedett. A gyermekek kreatinin szintje is kétszerese volt a felnőttekének, a Hgb és a Thrc szám pedig jelentősen alacsonyabb, mint a felnőttekben (10,1 gramm/liter illetve 51000/ mm3). 

A németországi járványt egy Shiga toxin termelő O104:H4 szerotípusú E. coli törzs okozta. Biokémiai jellemzőit tekintve atörzs sorbitol fermentáló 24 órán belül (az O157:H7 szerotípusú EHEC törzsek nem sorbitol fermentálók), laktóz bontó és béta glukuronidáz pozitív és subtilase negatív. Shiga Toxin 2a variánst termel (STX2A), más shiga toxint termelő E. coli törzsben kimutatott virulencia géneket, mint stx1, eae, ehx (enterohemorrhagic E. coliplazmidon kódolt enterohaemolysin) toxint nem tartalmaz. Ezen kívül enteroaggregatív E. coli (EAEC) virulencia génekkel, az attA, aggR, aap, aggA, aggC génekkel is rendelkezik. Ezek a gének virulencia plazmidon helyezkednek el. A plazmid nem tartalmaz hőstabil enterotoxint (EAST-1). Az izolátumok ESBL (kiterjedt spektrumú béta laktamase/extended spectrum beta lactamase enzyme) komplex termelők, CTX-M15-t és béta lactamáz TEM1-et termelnek, de érzékenyek karbapenemekre és ciprofloxacinra. A szerzők megjegyzése: terápiás jelentősége a rezisztenciának/érzékenységnek nincs, mert az antibiotikus kezelés a klinikai helyzetet rontaná, ezért antibiotikus kezelés nem jön szóba.

Az enzimatikus rezisztencia mechanizmusok

Az enzimatikus bakteriális rezisztencia mechanizmus nagyon ősi, mintegy 450 milló éves, az antibiotikumok orvosi használata előtt is meglévő, a baktériumok számára szelekciós előnyt biztosító mechanizmus. Az első béta-lactamázt termelő baktériumot (E. coli törzs volt) 1940-ben, a penicillin terápiás bevezetése előtt írták le. 1965-ben klinikai eset kapcsán figyelték meg a mobilis elemen elhelyezkedő béta-laktamázt, amelyet a beteg neve után Temoniera-nak (TEM) neveztek.

Az antibiotikumok kiterjedt használatával az elmúlt 70 évben a rezisztencia a szelekció révén terjedt.

Ma a béta-laktamázok számos tagja és több osztályozási rendszere ismert (Bush-Jacoby-Medeiros, Ambler). Az ESBL (extended spectrum beta lactamase, kiterjedt spektrumú) béta-lactamázok A osztályába tartoznak az SHV, TEM, CTX-M,és KPC enzimek, a D osztályába az OXA enzimek. Mindegyik típusnak nagyszámú variánsa ismert. Ma ezek molekuláris biológiai módszerekkel, szekvencia analízissel azonosíthatók. Az Enterobacteracea fajokban a kromoszómális elhelyezkedésű béta-laktamázok igen elterjedtek. Ezek a gének átkerülhetnek mobilis genetikus elemekre (plazmidok, transzpozonok), és így nem csak klonálisan, hanem horizontálisan is terjedhetnek. A jelenleg elterjedt széles spektrumú béta lactamázok (ESBL) elsősorban mobilis elemeken találhatók, de kromoszómálisan kódolt ősöktől származtathatók. Jellemző inzerciós szekvenciák jelenléte kapcsolható egyes béta-lactamáz génekhez (SHV-k, CTX-M).

Az Enterobacteriaceae kromoszómális béta-lactamázai: AmpC, SHV-1, K1, CX-ase. Az első plazmidon kódolt AmpC béta lactamázt 1989-ben figyelték meg. Jelenleg az aminosav összetétel alapján 7 családjuk ismert. Az OXA béta-lactamázok mobilis elemeken, plazmidokon, transzpozonokon, integronon helyezkednek el.

A kiterjedt spektrumú béta-lactamázok elnevezése 1988 óta ismert. Elterjedt definiciójuk alapján képesek az oxyimino-cephalosporinok, a monobaktámok és a széles spektrumú penicillinek hidrolízisére, nem bontják a carbapenemeket és a cefamicineket.

A fontosabb ESBL családok a következők: SHV (134 típus), TEM (182 típus, 92 ESBL), CTX-M (Cefotaximase-München enzimcsalád, több mint 90 típus, Kluyvera sp. kromoszómáiból mobilizálódott plazmidokra inserciós szekvenciákkal, a legelterjedtebbek a világon, a CTX-M 15 fordult elő a németországi járvány során), OXA (160 típus). A többi típus, PER, VEB, SFO, TLA, BES, GES-1, IBC, BEL ritka, egy, vagy néhány esetben került azonosításra.

A baktérium törzsek között gyorsan elterjedt a penicillináz termelő képesség. Ezt követően penicillináz rezisztens béta-laktám antibiotikumokat fejlesztettek ki, a methicillint, oxacillint. Ezekkel szemben is kiterjedt rezisztencia alakult ki.

A béta-lactamázok klasszifikációja

Funkcionális klasszifikáció

1.  csoport

Cephalosporinázok (molekuláris klasszifikáció C osztálya), clavulánsavval nem gátolhatók.

2.  csoport

Penicillinázok, cephalosporinázok (molekuláris A és D osztályba tartoznak), clavulánsavval gátolhatók. A TEM és SHV gének termékei. Az azonosított enzimek száma folyamatosan növekszik. Alosztályaik a következők.

2a csoport

Csak penicillinázok (molekuláris A osztályba tartoznak).

2b csoport

Széles-spektrumú béta laktamázok, amelyek penicillint és cephalosporinokat is képesek inaktiválni. A 2b csoporton belül különválasztottak két alcsoportot.

2be (extended) alcsoport

Kiterjesztett spektrumú (extended) csoport (molekuláris A osztályba tartoznak), amely az ESBL (extended spectrum beta-lactamase) csoportot reprezentálja, amely a harmadik generációs cephalosporinokat (ceftazidime, cefotaxime, cephpodoxime)  és a monobaktámokat (aztreonam) bontja.

Az Enterobacteriaceae család tagjai általában termelnek plazmidon kódolt béta-lactamáz enzimeket, TEM-1-et, TEM-2-t, SHV-1-et. Ezek az enzimek penicillin bontók, de nem bontják a kiterjesztett spektrumú cephalosporinokat. Az 1980-as évek közepétől kezdődött az új enzimek, a kiterjeszett spektrumú béta-lactamázok (ESBL) kimutatása. Az első ilyen enzimet Németországban 1983-ban ismerték meg.

Az ESBL-ek olyan penicillinázok, amelyek egy oxy-imino oldallánc révén hidrolizálják a kiterjedt spektrumú cephalosporinokat, a cefotaximot, ceftriaxont, ceftazidint és az oxy-imino-monobactamot (aztreonam), valamint rezisztenciát biztosítanak a rokon oxy-imino-béta-lactam antibiotikumokkal szemben is. Az ESBL enzimek típusosan a TEM-1, TEM-2 és SHV-1 enzimekből mutációk révén alakultak ki. A mutációk megváltoztatják az aktív hely környékén az aminosav konfigurációt, amely kiterjeszti az enzimek hidrolitikus spektrumát. Újabban egyre növekvő számú, nem TEM, illetve SHV eredetű ESBL enzimet találtak. Az ESBL-eket kódoló plazmidok gyakran hordoznak más antibiotikum rezisztenciát kódoló géneket is (pl. aminoglikozid rezisztenciát), amelynek következtében az ESBL-t termelő törzsek ellen hatékony antibiotikus kezelési lehetőségek limitáltak. A carbapenemek a lehetséges antibiotikus terápiás lehetőségek az ESBL-t termelő törzsek okozta fertőzésekben. Újabban azonban több carbapenem rezisztens izolátumot találtak és különböző carbapenemázokat jellemeztek (IMP, VIM, OXA, KPC, CMY, SME, IMI, NMC, CcrA, NMD-1, később részletezve). 

2br (resistant)

Inhibitor rezisztens alcsoport (molekuláris A osztályba tartoznak), clavulánsav és sulbactam inhibitorokat kevésbé kötő enzimek. TEM eredetú inhibitor rezisztens csoportnak is nevezik őket.

2c csoport

Carbenicillináz enzimek (molekuláris A osztályba tartoznak). Ezek az enzimek a carbenicillint hatásosabban bontják, mint a benzilpenicillint, és képesek a cloxacillin bontására is.

2d csoport

Cloxacillinázok (molekuláris D és A osztályba tartoznak), vagy pontosabban oxacillinázok (bontják az oxazolylpenicillineket, oxacillint, cloxacillint, dicloxacillint). Ezek az enzimek a cloxacillint hatásosabban bontják, mint a benzilpenicillint, és hatékonyak a carbenicillinnel szemben is. Néhány enzim ESBL tulajdonságú. Clavulansav a működésüket nem gátolja.

2e csoport

Cephalosporinázok (molekuláris A osztályba tartoznak), amelyek bontják a monobaktámokat és clavulánsavval gátolhatók.

2f csoport

Carbapenemázok (molekuláris A osztályba tartoznak), amelyek szerin alapúak (összehasonlítva a 3. csoportba tartozó cink-alapú metalloenzimekkel).

3.  csoport

Metalloenzimek (molekuláris B osztályba tartoznak). Zn alapú vagy metallo-béta laktamázok, amelyek enzimaktivitása cink ion függő. A metallo-béta laktamázok hidrolizálják a penicillineket, cephalosporinokat és a carbapenemeket. Clavulansav az aktivitásukat nem gátolja. A carbapenemeket mind a 2f (szerin), mind a 3 (cink) mechanizmussal működő enzimek képesek bontani.

4.  csoport

Penicillinázok, clavulansavval nem gátolhatók, nincs molekuláris osztályozásuk.

Molekuláris osztályozás

A béta-lactamázok molekuláris osztályozása a gének nukleotid szekvenciáján és a kódolt enzimek aminosav szekvenciáján alapul. Jelenleg négy osztály, A-D, került felismerésre. Az A, C és D molekuláris osztályok szerin alapúak, a B osztály vagy metallo-béta-lactamase-k Zn alapúak.

 A osztályú enzimek

TEM béta lactamázok

A Gram negatív baktériumok leggyakoribb béta lactamáz enzime a TEM-1. Ez az enzim felelős az ampicillin rezisztens  E. coli törzsek 90%-ban a béta lactam antibiotikumokkal szembeni rezisztenciáért. Később ez az enzim okozta H. influensae és a N. gonorrhoeae egyre fokozódó ampicillin és penicillin rezisztenciáját is. A TEM típusú béta lactamase-ok az E. coli és K. pneumoniae törzsekben fodulnak elő, de egyre gyakrabban figyelhetők meg más Gram negatív baktériumokban is. Az ESBL fenotípus kialakulálásért felelős aminosav cluster az enzim aktív helye körül található, a konfigurációs változás nyitottabbá teszi az enzim aktív helyét, így az enzimek képesek az oxi-imino béta lactam szubsztratok megkötésére és bontására is. Az aktív hely kinyílása lehetővé teszi az inhibitorok bekötődését is, így lehetővé válik a clavulansav gátló hatása (ez a funkcionális osztályozás egyik alapja). A TEM1 104-es, 164-es 238-as és 240-es pozíciójú aminosavainak mutációja ESBL fenotípust hoz létre, a szélesebb spektrumú ESBL-k esetében azonban rendszerint több aminosav cseréje is kialakul. A különböző kombinációk alapján jelenleg mintegy 200TEM típusú enzimet írtak le, az USA-ban a TEM 10, 12, 26 a leggyakoribb.

SHV beta lactamázok

Az enzimek struktúrája hasonlít a TEM típusúakhoz, az SHV1 68%-os aminosav azonosságot mutat a TEM1-vel. Az SHV1 a leggyakrabban a K. pneumoniae-ben található és a Klebsiella törzsek 20%-ában felelős a plazmidon kódolt ampicillin rezisztenciáért. Az SHV család esetében is megfigyelhetők aminosav változások az aktív hely körül, leggyakrabban a 238 és a 240-es pozícióban, amelyek szintén ESBL fenotípusokat hoznak létre. Jelenleg több mint 130 SHV variáns ismeretes. Az SHV variánsok a predomináns ESBL típusok Európában és az USA-ban, közülük a leggyakoribbak az SHV 5, 12.

CTX-M beta lactamázok

Az elnevezés onnan származik, hogy az enzim nagyobb aktivitást mutat a cefotaxim ellen, mint a többi oxy-imino beta lactam szubsztrát, pl. ceftazidim, ceftriaxon, és cefepim ellen. Ezek az enzimek nem mutációk következtében alakultak ki, hanem a Kluyvera speciesek (általában kommenzális organizmusok) kromoszómáján található beta lactamáz gének plazmidok által történő akvizíciója révén. Ezek a típusú enzimek csak 40%-os identitást mutatnak a két gyakori béta lactamáz típussal, a TEM-vel és az SHV-vel. Jelenleg közel 100 CTX-M enzim ismert. Az enzimek aktivitása változékony, néhányról kiderült, hogy a ceftazidimmel szemben nagyobb aktivitást mutatnak, mint a cefotaxim ellen. Ezek az enzimtípusok leggyakrabban S. enteritica (typhimurium serovariáns), E. coli és más enterobacteriaceae törzsekben fordulnak elő. Ezek a predomináns ESBL típusok Dél-Amerikában és egyre gyakrabban fordulnak elő Kelet-Európában, ahol a CTX-M 14, 3, 2 a leggyakoribbak. 2006-tól a CTX-M 15 a leggyakoribb enzim az Egyesült Királyságban az E. coli törzsekben és gyakoriságának növekedését hazánkban is leírták.

C osztályú enzimek

AmpC típusú béta lactamázok

Az AmpC típusú beta lactamázokat kiterjedt spektrumú cephalosporin rezisztens Gram negatív baktériumokból izolálták (funkcionális csoprotosításban 1-es csoport). Típusosan számos Gram negatív baktérium (Citrobacter, Serratia, enterobacteriaceae) kromoszómáján kódolt enzimek, az expressziójuk inducibilis. Az E. coliban is előfordulnak, ahol azonban nem inducibilis, viszont az enzim  hiperexpressziója figyelhető meg. Az AmpC típusú beta lactamázok plazmidokon is megtalálhatóak. Az AmpC béta lactamázok kiterjedt spektumú enzimek, cephalosporinokat, cefamycineket és oxy-imino beta lactamokat hidrolizálnak ésnem gátolhatók béta lactamáz inhibitorokkal.

D osztály enzimtípusai

OXA béta lactamázok

Plazmidon kódolt, oxacillint és rokon anti-staphylococcus penicillineket hidrolizáló béta lactamázok. Ezek a béta lactamázok különböznek a TEM és SHV enzimektől, a D molekuláris osztályba és a 2d funkcionális csoportba kerültek besorolásra. Erős hidrolitikus aktivitást mutatnak az oxacillin és a cloxacillin ellen és a clavulansav az aktivitásukat csak igen gyengén gátolja. Az OXA beta lactamázok rezisztenciát közvetítenek az ampicillin és a cephalotin ellen is. Az OXA enzimek aktív helye környékén lévő aminosavak cseréje szintén eredményezheti ESBL fenotípus kialakulását. Az OXA típusú ESBL-k többnyire a P. aeruginosa-ban találhatók, szemben a korábban említetekkel, melyek az E. coli-ban és a K. pneumoniae-ben. OXA típusú ESBL-eket elsősorban törökországi és franciaországi Pseudomonas izolátumokban találtak. Az OXA beta lactamázokat eredeteileg fenotípus csoportként jellemezték, a csoport tagjai között 20% szekvencia homológia figyelhető meg. Újabban kimutatott enzimek megismerésével kiderült, hogy egyesek főként ceftazidim rezisztenciát közvetítenek, mások pl. az OXA17 cefotaxim és cefepim rezisztenciát. Jelenleg mintegy 160OXA enzim ismert.

Más, plazmid mediált ESBL fenotípusú enzimeket is leírtak. Ezek ritkábbak, többnyire a P. aeruginosa és enterobacteriaceae törzsekben találhatók és jelenlétük néhány geográfiai régióra korlátozódik (PER, VEB, GES, IBC, BES, SPO, TLA beta lactamázok).

Inhibitor rezisztens béta lactamázok

Ezek nem ESBL fenotípusú enzimek, de gyakorta az ESBL-ekkel kerülnek említésre, mert a klasszikus TEM és SHV típusú enzimekből származtathatók. Eleinte inhibitor rezisztens TEM beta lactamázoknak (IRT) nevezték őket, a későbbiekben azonban a TEM-ek számozásával kerültek megjelölésre. Legalább 20 inhinitor rezisztens TEM beta lactamáz került leírásra E. coli,

Klebsiella, Proteus ésCitrobacter törzsekben. Ezek a TEM variánsok rezisztensek clavulansav és sulbactam gátló hatására, de érzékenyek a tazobactam gátló hatására. Későbbeikben megfigyelték a Tazobactam rezisztenciát is.

Carbapenemázok

A carbapenemek ellenállóak az AmpC és az ESBL típusú enzimekkel szemben. Célpontjaik a penicillinkötő fehérjék. A carbapenemáz enzimek külön csoportot képeznek a béta lactamázokon belül, nem csak az oxy-imino cephlaosporinokat, a cephamycineket, hanem a carbapenemeket is képesek hidrolizálni. A carbapenemázokról korábban úgy gondolták, hogy az A, B, D molekuláris osztályokba tartoznak, de C osztályba tartozókat is megismertek. A carbapenemáz enzimek a baktérium fajok csoportosítása alapján 6 távoli rokonságot mutató ágba tartoznak. Az egyes clusterek között az aminosav szekvencia azonosság 32-70 %. A legnagyobb diverzitás az A osztályú carbapenemázok között figyelhető meg  (GES1-9, IMI, KPC 1-4, NMC, SHV, SME)

GES (Guiana extended spectrum) carbapenemáz enzimek

A GES Francia Guianaban egy gyermek K. pneumoniae fertőzéséből került azonosításra . A GES carbapenemáz aktivitása alacsony, így az enzimek inkább ESBL-ek, mint carbapenemázok. Az enzimcsalád tagjait megtaláltak Európában, Dél Afrikában, a Távol Keleten Pseudomonas aeruginosa, Klebsiella pneumoniae, Serratia marcescens, E. coli, Enterobacter cloacae törzsekben. Génje és a regulátor (blaGES, beta lactamase gene) plazmidon vagy kromoszomálisan helyezkedhet el.

KPC ( K. pneumoniae carbapenemase) enzimek

Molekuláris A osztályba tartoznak, plazmidon kódolt, carbapenemázok, 4 fő variánsuk egy-három aminosavban különbözik egymástól. A KPC 2-nek és 3-nak több alvariánsa ismert (KPC2: c, d, e, f, g, h, j, KPC3: l, m, n). Az USA-ban kerültek leírásra. Az enzimek génjei (blaKPC) általában önátvitelű plazmidokon kódoltak, de kromoszomálisan is előfordulhatnak (pl. a KPC2 esetén, ez kolumbiai P. aeruginosa izolátum). Rendkívül gyakoriakká váltak világszerte. Klebsiella, E. coli, Citrobacter, Enterobacter, Serratia, Pseudomonas törzsekben figyelték meg őket.

SME (S. marcescensenzyme)carbapenemáz enzimek

A Serratia marcescens törzsekben fordulnak elő, 3 variánsuk (SME 1, 2, 3) került kimutatásra az Egyesült Királyságban és az USA-ban. A gén és a regulátor (blaSME) kromoszómán helyezkedik el.

IMI/NMC-A enzimek (imipenemase/non-metallocarbapenemase)

Enterobacter törzsekben írták le őket Franciaországban, Kínában, az USA-ban és Argentinában. Az enzimek két alosztálya, az IMI (IMI 1, 2) és az NMC-A ismert, amelyek 8 aminosavban különböznek. Génjük és a regulátor, a blaIMI esetében plazmidon (blaIMI2) is és kromoszómán (blaIMI1) is jelen lehet, a blaNMC-A elhelyezkedése kromoszómális. 

SFC-1 and SHV-38 enzimek

Az SFC-1 a S. fonticola, az SHV-38 K. pneumoniae izolátumból származó enzim. Az előbbi portugál környezeti izolátum, az utóbbi francia törzsben fordult elő. Génjeik kromoszómális elhelyezkedésűek. Az SHV- 38 1 aminosavban különbözik a széles spektrumú béta laktamáz SHV-1- től.

IMP (imipenem) típusú carbapenemázok

Metallo-béta laktamázok közé tartoznak, plazmidon kódoltak (gén blaIMP). A 90-es években Japánban figyelték meg őket enteralis Gram negatív baktériumokban Pseudomonas és Acinetobacter speciesekben. A törzsek terjedését megfigyelték a Távol-keleten, és 1997-től Europában, Kanadában és Braziliában is megjelentek. Legalább 17 variánsuk ismert.

VIM (Verona integron encoded metallo-béta-lactamase) enzimek

A 90-es években Olaszországban találták, legalább 10 családtagjuk ismert. Elterjedt Europában, az USA-ban, a Távol-keleten, Dél-Amerikában. Eredetileg a VIM1-et találták meg P. aeruginosa-ban, de a későbbekben a VIM2 lett a domináns variáns Európában és a Távol keleten. Az aminosav szekvencia diverzitás a VIM család tagjaiban 10%-os, az IMP családban 15%-os, a két család, a VIM és IMP között pedig 70%-os. A két enzimcsalád hasonló, mindkettő integronnal (gének blaVIM és blaIMP) társult és alkalmanként konjugatív plazmidon is elhelyezkednek. Mind a VIM, mind az IMP enzimek minden béta lactamot hirdolizálnak.

OXA (oxacillinase) béta lactamázok

Molekuláris D osztályba tartoznak, főként az Acinetobacter-ekben fordulnak elő, két clusterbe oszthatók. Az OXA carbapenemase-ok a carbapenemeket nagyon lassan hidrolizálják. A gének plazmidon kódoltak.

CMY

2006-ban került leírásra Enterobacter aerogenes-ből, a pYMG-1 plazmidon kódolt (gén blaCMY), ez az első C osztályú carbapenemase, amely leírásra került. Citrobacter freundii izolátumokból 30 variánst izoláltak.

NDM-1 (New Delhi metallo-beta lactamase)

2009-ben New Delhiben került felismerésre. Indiából és Pakisztánból rövid idő alatt szétterjedt, megjelent az USA-ban, az Egyesült Királyságban, a turizmus globalizációs következményeként(Walther-Rasmussen J, Høiby N. Class A carbapenemases. J Antimicrobial Chemotherapy 2007, 60, 470–482).

A német Nemzeti Referencia Centrum 650 baktérium mintából 439-t tipizált STX termelésre vagy stx jelenlétére, és 60 izolátum analízise történt PFGE analízissel. Valamennyi törzs azonosnak bizonyult.

A németországi járvány több eltérést mutat a korábbi nagy stx termelő járványokhoz képest. Az 1996-s Japán Sakai járványban 121 HUS snydroma fordult elő, valamennyi gyermekekben. A német járvány sajátsága, hogy a HUS az esetek l/4-ben fordult elő (834 HUS, 2967 nem HUS, 100 eset 12 további országban, EU, USA, Canada, 30 HUS haláleset, 16 nem HUS haláleset), ami nagyobb gyakoriságú, mint más járványok esetén. A második sajátság, hogy a HUS szindróma az esetek többségében (mintegy 89%) nem gyermekekben, hanem felnőttekben fordult elő, és a felnőttek között is elsősorban nőkben. A harmadik sajátosság a kórokozó típusa, a szokatlan O104:H4 törzs volt. A járványból izolált törzs két különböző hasmenést okozó E. coli pathotípus virulencia sajátosságait egyesítette, az enteroaggregatív és az stx termelő enterohaemolyticus E. coli törzsekét. Egyes kutatók úgy gondolták, hogy az enteroaggregatív E. coli törzs akvirálta az stx2A-t kódoló bakteriofágot, mások szerint egy progenitor O104:H4 törzsből származtak a variánsok. Már korábban is leírtak enteroaggregatív shiga toxint termelő HUS-t okozó E. coli törzset. Egy hasonló, shiga toxint termelő O104:H4 E. coli törzs került izolálásra 2001-ben egy HUS-ban szenvedő  testvérpárból Németországban (HUSECO41, 01-09591, történelmi O106:H4 törzs), azonban ennek a törzsnek a fimbriái különbséget mutattak a mostani törzshöz képest (AAF/III vs. AAF/I). Hasonló HUS eset előfordulását írták le Dél-Koreában (Bae WK, Lee YK, Cho MS, Ma SK, Kim SW, Kim NH, Choi KC. A case of hemolytic uremic syndrome caused by Escherichia coli O104:H4. Yonsei Med J 2006, 47,437-439). Egy 29 éves nő hasi fájdalom és véres széklet miatt került felvételre, és észlelték a HUS kialakulását. A kórokozó szintén O104:H4 törzs volt.  3 hetes plazmaferezis és hemodialízis után a beteg meggyógyult. Az észlelés során neurológiai tünetek is előforultak, hasonlóan a németországi esetekhez. Koponya CT vizsgálattal eltérést nem detektáltak.

A típusos enteroaggregatív törzseket elsősorban emberekből izolálják, ezért úgy gondolják, hogy ezek a járvány nem zoonotikus kiindulásúak.

A járványban a HUS kialakulásának aránya 25%-s volt, annak ellenére, hogy a hatóságok a lakosságnak kifejezetten tanácsolták, hogy véres hasmenés esetén keressenek fel egészségügyi intézményeket. A prospektív observatió során is 20%-ban észlelték a kórházban a HUS syndroma kifejlődését a Shiga toxint termelő E. coli hasmenéssel kórházban kezelt betegek között. Ez az arány lényegesen magasabb, mint a korábbi járványok során megfigylet HUS gyakoriság, amely az O157:H7 STEC törzsek esetén az USA-ban átlagosan 6% körüli volt. Úgy gondolják, hogy a németországi járvány kórokozója különösen virulens volt. A járvány során izolált Shiga toxin variánst korábban Németországban csak egy ritka, sorbitolt fermentáló O157:H- STX termelő E. coli törzsből izolálták. Ez is egy hipervirulens kórokozó volt, gyermekekben okozott megbetegedést és jelentős mortalitással társult.

Érdekes sajátossága a kórokozónak a nyolc napos medián lappangási idő, amely hosszabb, mint az STEC O157:H7 coli törzsek 3-4 napos medián inkubációs periódusa. A hasmenéses betegek követése során nem találtak nemre jellemző rizikófaktorokat a HUS kifejlődése szempontjából, e miatt továbbra is kérdés a németországi járvány során megfigyelt női dominancia oka. Az is kérdéses, hogy az atípusos kormegoszlás pusztán az expozícival összefüggő különbség, vagy a kórokozó törzs pathogén sajátsága, esetleg mindkettővel összefüggő.

Az O104:H4 törzs nem rendelkezik az eae gén által kódolt intimin intestinalis adherencia faktorral, amely valószínűleg fontos virulencia tényező a gyermekek esetében. Az eae gént az STEC törzsek okozta gyermekkori gastroenteritisekből száramzó izolátumokban 3 éves kor alatt 85%-ben mutatták ki korábban Németországban, és a HUS-val járó megbetegedések esetén gyermekekben a törzsek 97%-a tartalmazta a gént németországi és osztrák esetekben. Felnőttek sporadikus STEC okozta gastroenteritise során izolált törzsekben viszont hiányzik az eae gén, és eae negatív törzseket is leírtak felnőttkori HUS megbetegedések kóroki tényezőjeként.

Felnőttekben a leggyakoribb klinikai tünet a hasgörcsökkel társuló véres hasmenés. A felnőttekben megfigyelt klinikai kép különbözött a gyermekekben észlelttől, véres hasmenés a felnőttekben, hányás a gyermekekben jelentkezett gyakrabban. A véres hasmenés magasabb aránya lehet a törzs pathogén sajátosságainak következménye, de lehet annak a nyilvánosságnak szóló tanácsnak a következménye, hogy mindenki forduljon véres hasmenés esetén orvoshoz. A hasi fájdalom, a hasmenés, a lazább széklet gyakorisága nem különbözött HUS-ban szenvedő betegekben, a csak gastroenteritises csoporthoz képest. A veseelégtelenségre és hemolízisre utaló laboratóriumi értékek gyakran a kórházba kerülés első 24 órájában már kialakultak.

A HUS-ra legérzékenyebb laboratóriumi leletek a thrombocyta szám, LDH, kreatinin szint voltak. Több beteg beszámolt arról, hogy néhány napon belül kezdett felépülni a véres hasmenésből, viszont ebben az időszakban alakult ki a HUS. Az is lényeges megfigyelés, hogy számos jelentett esetről kapott információ nem tartalmazott pontos tüneteket, (pl. hasmenés vagy véres hasmenés) és elég sok esetben nem állt rendelkezésre mikrobiológiai információ sem. A HUS klinikai képének felnőttekben történt kialakulása specifikusan jellemző volt erre a járványra. Az átviteli utak közül a háztartáson belüli átvitel előfordult Hollandiában. Egyes esetekben további komplikációt jelentett az életet veszélyeztető bél ischaemia fellépése. Epidemiológiai és mikrobiológiai evidenciák alapján úgy gondolják, hogy az O104:H4 törzsek átvitelében a görögszéna csíra lehetett e közvetítő.

A NEJM 2011 július 27-i közleményében nemzetközi szerzőcsoportok elemezik az STEC O104:H4 törzsek genomját (Rohde H, Qin J, Cui Y, Li D, Loman NJ, Hentschke M, Chen W, Pu F, Peng Y, Li J, Xi F, Li S, Li Y, Zhang Z, Yang X, Zhao M, Wang P, Guan Y, Cen Z, Zhao X, Christner M, Kobbe R, Loos S, Oh J, Yang L, Danchin A, Gao GF, Song Y, Li Y,Yang H, Wang J, Xu J, Pallen MJ, Wang J, Aepfelbacher M, Yang R and the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium. Open-Source Genomic Analysis of Shiga-Toxin–Producing E. coli O104:H4.  NEJM 2011. 10.1056/nejmoa1107643 nejm.org,).

A NEJM cikk egy Észak-Német családi betegség cluster analízisét és a kórokozó genomjának vizsgálatát írja le. Egy 16 éves lány került május 17-én felvételre a Hamburg Eppendorf Egyetemi Orvosi Centrumba hasi fájdalommal és véres hasmenéssel. Még aznap 12 éves öccse is felvételre került két napos fejfájással, egy napos hányással és nem véres hasmenéssel. A fiúnál észlelték az acut veseelégtelenség tüneteit, a thrombocytopaeniat és a hemolitikus anémiát. A fiú Hgb szintje a felvételt követően 8,4 g/100 ml-re esett. A gyerekek és a szüleik, valamint egy fiatal barátjuk egy héttel a felvétel előtt babcsírát is tartalmazó salátát fogyasztott. Az anya tünetmentes maradt és a székletében sem volt stx termelő coli. Az apánál HUS alakult ki és székletében kimutatható volt a STEC törzs, a barátnak hasmenése lett, de nem került kórházi felvételre. A testvérek székletmintáját sorbitol-MacConcay agaron tenyésztették és folyékony dúsító kultúrákban inkubálták. A következő napon a folyékony kultúrák felülúszóját ELISA módszerrel vizsgálták Shiga toxin jelenlétére. A sorbitol pozitív coloniát Maldi-Tof (matrix assisted laser desorption ionization - time of flight, tömegspektroszkópia) módszerrel E. coli törzsként azonosították. Néhány colonia PCR technikával pozitívnak bizonyult stx2 génre, és negatívnak stx 1 és eae génekre. Polivalens tipizáló szérumokkal a törzs nem bizonyult stx termelő, gyakori E. coli szerotípusnak. Később sikerült szerotipizálással a ritka, O104:H4 szerotípus azonosítása. Kimutatták azt is, hogy a törzs ESBL géneket, CTX-M15 és TEM1-et tartalmaz. A 16 éves lány kórlefolyása enyhe volt, nem mutatkoztak a HUS tünetei és még aznap elbocsátották a kórházból. A fiú kórlefolyása sokkal súlyosabbnak bizonyult, 9 napos peritonealis dialízis után Hgb szintje és thrombocyta száma emelkedett, de súlyos neurológiai tünetei alakultak ki, szomnolencia, látás és beszédzavar, hemiplegia és inkontinencia lépett fel. Négy alkalommal plazmaferezisben, és anti-C5 antitest (eculizumab, Soliris,humanizált monoclonális IgG2/4κ antitest, a korábban transzfúzióban részesült, paroxismusos noctrunális haemoglobinuriában (PNH/ illetve atípusos HUS-ban szenvedő betegek kezelésére javasolt C5 komplement komponenst kötő és a komplement rendszer terminális aktivációját, a C5b-9 komplex kialakulását gátló antitest) adásában részesült.

A komplement komponens 5 (CO5) a komplement rendszer tagja, fontos szerepet játszik a gyulladásos és a komplement rendszer okozta sejtpusztulási folyamatokban. Diszulfid kötött alfa és béta alegységből felépülő fehérje, amelyet a C5 konvertáz enzim komplex aktivál (a klasszikus komplement út C5 konvertáz enzim komplex a C4bC2aC3b komplement fehérje fragmentumokból, az alternatív C5 konvertáz pedig a /C3b/2Bb protein hasadási termékből épül fel).  Az alfa polipeptidből keletkező C5a anaphylatoxin, spazmogén és kemotaktikus. A C5b komplexet képez a C6 komplement komponenssel, amely a membránkárosító komplex felépülésének első lépése. CO5: 9q33-q34, 122840 bp, 1676 AA, 188305 Da, 131 fehérje kapcsolat, 1265 SNP, www.genecards.org.

Az anti-C5a antitest kezelés után a fiú állapota javult és 24 nap után elbocsátották a kórházból. Maradvány neurológiai tünetek miatt rehabilitációs kezelés vált szükségessé.

A 16 éves lányból izolált kórokozó (TY2482) szekvencia analízisét ion torrent szekvenálási technikával, personal genome machine (PGM) apparátussal végezték a Beiging Genomic Institute kutatói, Shenzen, Kína. A kezdeti eredmények a DNS minta megérkezése után már három nappal elkészültek. Május 28-án érkezett meg az első DNS minta, és május 31 -én a második. Az első genom összeállítást június 2-án hozták nyilvánosságra, ami további analíziseket, multilocus sequence typing (MLST) elemzést, filogenetikus analízist, és genom összehasonlításokat tett lehetővé. Az egyes ion torrent hibákat korrigálták, a későbbi Illumina small-insert-library, illetve az Illumina nagy inzert szekvenálási adatok alapján. Június 16-ra gyakorlatilag elkészült a teljes genom génszekvencia. Három DNS könyvtárat készítettek, és a gyártó, a Life Technologies protokollja alapján hét szekvenáló futtatást végeztek (79 Mb terjedelmű szekvencia adat, átlagos leolvasási hosszúság 101 bp). Végeredményben a három DNS könyvtárból és a kisebb méretű inzert könyvtárakból nyert adatok alapján két héten belül jó minőségű genom szekvencia adatokat kaptak. Az adatokat elhelyezték a génbank short read archive adatbázisában, SRA037315 (ion torrent) és SRA039136 (illumina platform) jelölések alatt. A részletes géntérkép első verziója június 6-ra, a második verziója június 10-re készült el. Ez utóbbiban az stx2-t hordozó fág azonosítása is szerepel.

A szekvencia adatok nyílvánosságra hozása világszerte hatalmas érdeklődést váltott ki. 24 órán belűl elvégezték a genom összeállítását, öt nappal később megterveztek és nyilvánosságra hoztak törzs specifikus diagnosztikus primer szekvenciákat és egy héten belül két tucat analízist végeztek el a törzzsel kapcsolatban és jelentettek meg egy nyílt wiki website-on (a wiki név hawai eredetű, jelentése gyors, eredetileg a honolului repülőtéri terminálok közötti járatokra használják, illetve keresztnév. Egy hipertext rendszer és a szoftver elnevezése, lehetővé teszi, hogy az adott laphoz bárki új tartalmakat tegyen hozzá, ebben az esetben a csoportos munkavégzés támogatására, vagy online adatbázis kialakítására (lexikon, Wikipedia), vagy pl. közösségépítésre. Az első wiki kifejlesztője az amerikai computer programtervező, Howard G. "Ward" Cunningham (szül. 1949, Portland, Oregon, USA) volt.

  

Howard G. Cunningham

 A kép forrása: Internet

Ezek az analízisek információkat szolgáltattak a törzs virulencia és rezisztencia génjeiról, illetve a filogenetikus kapcsolatáról. Az ion torrent adatokat analízálták az E. coli MLST vizsgálati sémája szerint. Ez hét konzervatív housekeeping gén vizsgálatán alapul (adk, funC, gyrB, mdh, purA, recA, icd). Ez az analízis azzal a meglepő eredménnyel szolgált, hogy a Németországban 2001-ben izolált 01-09591 (szekvencia típusa ST678), az un. történelmi törzzsel szoros rokonság áll fenn. A TY2482 és a 2001-es izolátum az adk és a recA gének területén egy-egy bázisban különbözött (a második különbségről azóta kiderült, hogy PGM szekvencia hiba történt a kérdéses homopolimer régió technikailag nehéz leolvashatósága miatt). A 2001-es törzs O104:H4 szerotípusú volt, termelt shiga toxint és HUS kialakulásával társult, de nem tartalmazott TTSS géneket, amelyek típusosak az EHEC törzsek esetében. Az MLST analízis érdekessége, hogy a különbözó O104 szerotípusokban több MLST szekvencia típus is előfordul, ezzel szemben az O104:H4 szerotípusban csak az ST678. A TY2482-s genomot a korábban szekvenált, komplett E. coli genomokkal összehasonlítva kiderült továbbá, hogy az E. coli 55989 törzzsel 99,8%-os a nukleotid szekvencia azonosság. Ez a törzs a Közép-Afrikai Köztársaságban, egy felnőtt HIV fertőzött egyén vízszerű hasmenéséből került izolálásra. Ezt, mint enteroaggregatív EAEC coli törzset klasszifikálták, de a TY2482 törzshöz hasonlóan nincs eae génje. Az 55989 E coli törzset leíró szerzők, Mossoro és mtsai. korábban szintén leírtak egy Shiga toxin génnel rendelkező enteroaggregatív E. coli törzset is, egy Közép-Afrikai HIV fertőzött beteg hasmenéssel társuló HUS szindrómája kapcsán (Mossoro C, Glaziou P, Yassibanda S, Lan NTP, Bekondi C, Minssart P, Bernier C, Le Bouguenec C, Germani Y. Chronic diarrhea, hemorrhagic colitis, and hemolytic-uremic syndrome associated with HEp-2 adherent Escherichia coli in adults infected with human immunodeficiency virus in Bangui, Central AfricanAfrican Republic. J Clin Microbiol 2002, 40, 3086-3088).

A TY2482 és az 55989 kromoszómáinak összehasonlítása alapján úgy gondolják, hogy a kezdetben EHEC-nek tartott németországi kitörésért felelős törzs tulajdonképpen EAEC törzs. A TY2482 a 01-09591 korábbi német törzshöz hasonlóan nem tartalmaz LEE-t és a TTSS effektorokat kódoló géneket. Ezzel szemben a TY2482 genom EAEC-ra jellemző virulencia faktorokat kódol, és mind PCR vizsgálatokkal, mind sejt adherencia vizsgálatokkal úgy találták, hogy a törzs enteroaggregatív. Törzs specifikus gének azonosítására részletes kromoszóma analízist végeztek az enteroaggregatív 55989 és a TY2482 között. Azonosítottak néhány izolátum specifikus regionális különbséget, olyan nagyobb, 500 bp feletti régiókat, amelyek csak a TY 2482 kromoszómában voltak jelen, és fordítva, olyanokat, amelyek csak az 55989-es genomban szerepeltek. A TY2482 specifikus regionális különbségek profág maradványok, illetve intakt profágok voltak. Ezek közé tartozik az stx2 profág is, amely hasonlóan az O157:H7 EDL933 és a Sakai törzsek genomjához, a WrbA locus területére inzertálódott (NADPH:quinone oxydoreductase, typeIV NQO). Az stx gén a TY2482-ben csak egy nukleotidban különbözik az EHEC O157 EDL933 stx2 alléljétől. A főbb regionális differenciák a két törzs között a következők (ROD, regions of difference): jelen vannak a TY2482-ben és nincsenek jelen az 55989-ben (I-ROD inzerciók): IROD1 250 kb méretű degenerált profág remnant, IROD2 1100 kb-nál, stx 2 fág, IROD3 1200 kb-nál, tellurit rezisztencia és microcin gén cluster (kisméretű antibakteriális peptidek, bactriocinek, colicinnel együtt összesen 7 peptid), IROD4 1750 kb-nál profág, IROD5 2100 kb-nál profág, IROD6 2500 kb-nál molibdát metabolizmus regulátor (yehL, MoxR /transcriptionalis regulator/ AAA+ ATPase-ATPases Associated with diverse cellular Activities, ABC transporter család ATP kötő alegység, transporter, ismeretlen funkció), IROD7 4200 kb-nál gyógyszer rezisztencia (dfA7, suII, suIII, strA, strB, tetA,  higany rezisztencia).

Az 55989-ben jelen van és a TY2482-ben nincs jelen (D-ROD, deléció): DROD1, 2, 3, 4, 6 profág genomok, DROD5 type VI szekréciós gének. A szerzők az általuk készített genom összeállítás alapján úgy gondolják, hogy a TY2482 két nagy konjugatív plazmidot, a pESBL TY2482-t (88 kb) és a pAATY2482-t (76 kb), valamint egy kisméretű  pG2011 TY2482 (1,5 kb) plazmidot tartalmaz. A két nagy plazmid a kromoszómákkal 1:1 arányban replikálódik, a kis plazmid pedig ehhez képest 9x-es mértékben.

A pESBL-n helyekedik el a blc-CTX-M 15, és a béta lactamase TEM-1. IncI típusú plazmid (I-type incompatibility group), amelyet korábban egy ló arthritiséből izolált E. coli törzsben találtak (pEC Bactec).

A pAA plazmidon található az aggregatív adherencia fimbria I (AAF/I) gén. Ez a plazmid hasonlít az 55989 plazmidjához, amely azonban AAF/III-at kódoló géneket tartalmaz. Ezek gyakoribb aggregativ adherencia fimbria típusok. Ezt a ritka típusú AAF/I clustert használták a kutatók törzs specifikus PCR primer kidolgozására, a németországi járványt okozó törzs azonosításához.

A kis plazmidon fenotípussal összefüggésbe hozható gént nem azonosítottak.

Ez a szerzőcsoport úgy gondolja, hogy a németországi járványt okozó törzs eredetileg az 55989 EAEC pathotípusú törzshöz hasonló progenitorból származhatott. A járványt okozó képessége annak köszönhető, hogy akvirálta az stx2 profágot és a plazmidon kódolt CTX-M15 ESBL-t. Időközben a törzs elvesztette az AAF/III génclustert és akvirált egy másik, ritka, AAF/I fimbriát kódoló clustert.

Hasonló progenitor törzseket már leírtak három kontinensen (Afrika, Ázsia, Európa). Koreában 2005-ben az O104:H4 törzs okozott HUS-t, amelynek kapcsolata a jelenlegi német járvánnyal nem világos. Megfigyelték egy O104:H4 törzs, az  01-09591 HUS-val való társulását 2001-ben, Németországban.

Önmagában a genom szekvencia analízise nem tudja teljesen megmagyarázni a németországi törzs rendkívül magas fokú virulenciáját. Mind a kommenzális, mind a pathogén törzseknek túl kell élniük a bélrendszerben, azonban a puszta túlélés és önmagában a Shiga toxintermelő képesség nem elég sem a véres hasmenés, sem a HUS kialakulásához. A baktériumoknak a bél mucosájához kell tapadni, az EHEC törzsekben ezt az LEE locuson kódolt TTSS rendszer biztosítja, ami azonban nincs jelen a németországi kitörést okozó törzsben. Az új törzs más adhéziós mechanizmust használt, az aggregatív adherencia fimbriákat. A TY2482-es törzs kialakulása arra utal, hogy az E. coli pathotípusok átfedhetnek és tovább fejlődhetnek. A német coli törzs virulenciájához hozzájárulhatott az új típusú adhéziós mechanizmus. Ezen kívül a törzs feltehetően rendelkezik egy hatásosabb toxint felszabadító mechanizmussal is (a toxin hagyományosan az EHEC törzsekből csak a baktériumok lízise során szabadul ki).

Szerzői megjegyzés: ilyen jelentős járványt okozó virulencia tényezők acquirálása a törzs emberi szervezethez történő adaptációja szempontjából maladaptáció, semmilyen szempontból nem szolgálja a törzs zavartalan együttélését a gazdaszervezettel.

Az EAEC törzsek már korábban is okoztak járványokat növényi csíra fogyasztás kapcsán, 1993-ban Japánban például több mint 2000 ember betegedett meg.

Fontos lenne annak megértése, hogy a német kitörést okozó és más enteroaggregatív törzsek hogyan tapadnak és colonizálnak magvakon, illetve csírákon.

Végeredményben a szerzők nemzetközi kooperációban (a Hambrugi Egyetemi Orvosi Centrum, a BGI Shenzhen, a Dél-Kínai Egyetem Guangzhou, a Pekingi Mikrobiológiai és Epidemiológiai Intézet és a Kínai CDC, valamint a Burminghami Egyetem és az Amabiotics Francia Intézet munkatársai) nyílt, a világot az internet segítségével átívelő genomikai programba kezdve, új, nagy teljesítményű szekvenálási módszer alkalmazásával, és nyílvános adathozzáférési lehetőségekkel (wiki), valamint a bioinformatikai analízis eredményének világszerte történő közzétételével (crowd sourcing) példátlan gyorsasággal elvégezték a kórokozó genomjának szekvencia analízisét, amit világszerte hozzáférhetővé tettek.

A NEJM július 27-én megjelent számában egy másik szerzőcsoport, Rasko és mtsai, University of Maryland, School of Medicine (Rasko DA, Webster DR, Sahl JW, Bashir A, Boisen N, Scheutz F, Paxinos EE, Sebra R, Chin C-S, Iliopoulos D, Klammer A, Peluso P, Lee L, Kislyuk AO, Bullard J, Kasarskis A, Wang S, Eid J, Rank D, Redman JC, Steyert SR, Frimodt-Møller J, Struve C, Petersen AM,  Krogfelt KA, Nataro JP, Schadt EE, Waldor MK. Origins of the E. coli Strain Causing an Outbreak of Hemolytic–Uremic Syndrome in Germany.  NEJM 2011. 10.1056/nejmoa1106920 nejm.org.) szintén beszámolt egy 64 éves, a járványban megbetegedett nőből izolált E. coli (C227-11 elnevezésű izolátum) genom szekvencia vizsgálatáról, és az elemzés eredményeiről. A beteg a Koppenhágai Hvidovre Egyetemi kórházba került felvételre véres hasmenéssel. HUS nem alakult ki. Az E. coli O104:H4 szerotípusú törzs enteroaggregatív virulencia tulajdonságokat mutatott. A szerzők is megállapították, hogy a járványt okozó EAEC O104:H4 törzs hasonlóságokat mutat a Közép-Afrikai 55989-s törzzsel.

Az EAEC törzsek bizonyítottan tartalmaznak számos, az aggA transzkripciós faktor által szabályozott, virulenciával asszociálódott gént. Ezek közé tartoznak a plazmidon kódolt aggregatív adherencia fimbria (aaf) gének. A fimbriák járulnak hozzá a baktérium bélmucosához való kapcsolódásához és a gyulladás kialakulásához. A pathofiziológia fontos komponense egy protein burok szekréciója, amelynek alapvető része egy feltételezett VI-os típusú szekréciós rendszer (AAI, Agrobacterium autoinducer) és a dispersin (AAT protein coat secretion system). Az EAEC törzsek több toxint és változó számú szerin proteáz autotransporter enzimet (SPATE) termelnek, amelyek hozzájárulnak a mucosa károsodáshoz és a colonizációhoz. A jelenlegi EAEC O104:H4 járvány előtt három enteroaggregatív E. coli genomot szekvenáltak. Ennek következtében a teljes genom ismeretén alapuló filogenetikia elemzés és kategorizálás lehetősége limitált volt. Ez a szerzőcsoport is harmadik generációs, nagy teljesítményű DNS szekvenáló technológiát alkalmazott az E coli O104:H4 járványban szerepelő törzs, valamint 7 további enteroaggregatív E. coli O104:H4 és 4 referencia törzs szekvenálására. A szerzők 5 enteroaggregatív, korábban már tanulmányozott E. coli izolátumot, az IM221 O92:H33 Mexico, 17-2 O3:H2 Chile, O42:H18 Peru, 55989 O104:H4 Közép-Afrikai Köztársaság, valamint az C1010-00 O rough:H- Dánia izolátumokat választottak, a különböző, geográfiai, szerotípus és virulencia faktor diverzitás tanulmányozására. Ezen kívűl vizsgáltak még 6 O104:H4 klinikai izolátumot a Koppenhágai Statens Serum Institute izolátumai közül. Ezek a következők oltak: C35-10 O104:H4 Afrika, C68209 O104:H4 Afrika, C73409 O104:H4 Afrika, C76009 O104:H4 Afrika, C77709 O104:H4 Afrika. A törzsek nem klonális járványból származtak, hanem hasmenéses, illetve nem hasmenéses gyermekek szérum mintáiból izolálták őket. Ennek alapján a szerzők úgy gondolják, hogy a törzsek reprezentálják az O104:H4 szerocsoport populációs diverzitását. Négy további O104:H4 izolátumot is szekvenáltak, ezek közé tartozott három német, a TY2482 (ez a BGI kutatói  által szekvenált törzs), az LB226692, a H112180280, és egy dániai izolátum C227-11 (ez a jelenlegi szerzőcsoport által szekvenált törzs). Az utóbbi négy felnőtt hasmenéses székletmintáiból került izolálásra.

A kutatók három szekvenáló műszert használtak párhuzamosan, az átlagos leolvasási hossz 2067 bázis volt, minden izolátum esetében 75 átfedéssel. Egy izolátum szekvenálása kb. 5 órát vett igénybe. Egy integratív folyamat során 99,97%-s pontossággal össszeállították a C227-11 genomot. 33 contig (N50), 402 - 622 kb fedte le 99,97%-os pontossággal a bakteriális kromoszóma 99,97%-át.  Egy contig (contiguous) egy gap nélküli continuus DNS szekvencia, az N50 azon contigok összességének a hossza, amely a genom bázisainak 50%-át tartalmazza. Négy további contig fedte le a két nagy plazmidot (88 kb illetve 85 kb méretűek), valamint az 1,5 kb nagyságú plazmidot. Az 1,5 kb kis plazmidot két leolvasás teljesen lefedte. Az egyik plazmid hasonló a pAA plazmidhoz, amely tipikus az EAEC izolátumokban. A C277-11 pAA plazmidja (pAA C277-11) az aggregatív adherencia fimbria AAF/I variánsát kódolja. Tartalmazza az aat komplexet, a dispersin fehérjét, az aggr-t és más EAEC törzsekre jellemző virulencia faktorokat.

A szerzők összehasonlították a C227-11 törzs genom szekvenciáját 6 afrikai O104:H4,  egy másik, a járványból izolált, TY2482 törzzsel, valamint az afrikai EAEC 55989 törzs szekvenciájával. A német járványból izolált genomok, a C227-11 és a TY2482 csak 236 nukleotidban különböztek egymástól, mutatva, hogy klonális törzsekről van szó. Nagyobb méretű deléciókat, inzerciókat és inverziókat figyeltek meg a 7 másik,  EAEC O104:H4 törzzsel való összehasonlításban. Néhány divergens régió virulencia faktorokat kódol. A C227-11 két lambda szerű profágot tartalmaz, amelyek egyike a Shiga toxin gént hordozza. Ez a toxint kódoló fág csak ebben, a jelenlegi izolátumban figyelhető meg. A másik profág jelen van néhány más O104:H4 izolátumban is.

A német járványért felelős törzs a virulencia faktor gének sajátos kombinációját akvirálta, így a pic-t (mucináz aktivitású protein, amely a vörösvértestek haemagglutinációját is előidézi és jelen van az EAEC 042 és a Shigella flexneri 2A törzsekben is), és az aai patogenicitási szigetet (aaiA-P, VI-s típusú szekréciós rendszer tagjait kódolja, a pheU sziget területén inzertálódott, hatásmechanizmusa nem ismert, az EAEC-042 törzsben került felismerésre). Ez utóbbi terület különbözik a német járványt okozó és az 55989-s törzsekben.

A szerzők 2,56 Mb genom DNS szekvencia, a konzervált core genom alapján elemezték 53 E. coli és Shigella genom filogenetikus kapcsolatát. Azt figyelték meg, hogy az EAEC törzsek megoszlanak az egész filogenetikus fa területén és ezek a törzsek mutatják a legnagyobb diverzitást. Az EAEC O104:H4 szerotípus igen konzervatív core genomjával azonban egy külön ágat képez. A vizsgált O104:H4 izolátumok közül mindössze egy esik különálló ágba. A német járványból izolált Shiga toxint is tartalmazó törzsek nagyfokú hasonlósága a Shiga toxint nem tartalmazó EAEC O104:H4 törzsekhez arra utal, hogy a fág akvirációja új esemény lehetett. A járványból izolált O104:H4 törzs jelenléte az EAEC O104:H4 ágban alátámasztja, hogy a járványt okozó törzs nem EHEC, hanem egy enteroaggregatív E. coli törzs vette fel az EHEC-re jellemző egyes virulencia faktorokat. Tovább analizálva az EAEC izolátumok közös, 3,48Mb genom szekvenciáját, ismét egy egymással szoros rokonságban lévő ágba csoportosultak az O104:H4 izolátumok (a C35-10-es izolátum itt is kivételt képez). A német járványból származó négy coli izolátum, a TY2482, a C227-11, az LB226692 és a H11218280 egymáshoz nagyon hasonlónak bizonyultak.

A német járványból izolált EAEC törzsek stx2 gént tartalmaztak. A lambda szerű fág inzerciós helye hasonlít az E. coli EDL933 törzs lambda szerű fágjáéra (933 W), különösen a Shiga toxin gént határoló területeken, amelyek a Shiga toxintermelést és a toxin felszabadulást szabályozzák. Több EHEC törzs és a C227-11 szekvencia összehasonlítása azt mutatta, hogy az stx génrégió területén, a lambdoid profágban megtalálható az anti-terminációs protein Q, a feltételezett késői promoter (pR), a Shiga toxin 2A alegység (STX2A), a Shiga toxin 2B alegység (STX2B) és egy hipotetikus STX2B-vel szomszédos fehérje. Ez utóbbi régió nagyon konzervatív az EHEC és a C227-11 törzsekben. Az O157:H7 törzsekben az antibiotikum hatás elindítja bakteriális SOS választ, amely rendkívüli módon megnöveli a Shiga toxin termelését. Kvantitatív reverz transzkriptáz polimeráz láncreakcióval megvizsgálták a Shiga toxin gén ciprofloxacin hatására bekövetkező indukcióját. Az stx2B RNS expresszió ciprofloxacin hatására 83x-os emelkedést mutatott. Néhány EHEC törzzsel végzett vizsgálat azt mutatta, hogy a toxin termelés a pR promoter aktiválódásán keresztül jön létre. A pR promoter helyzete a C227-11-ben és az EDL933 törzsekben identikus, upstream elhelyezkedésű az stx2-hez képest.

A szerzők összefoglalták az EAEC O104:H4 törzs egyéb lehetséges virulencia faktorait is. Egyrészük termelődése az aggR transzkripcionális aktivátor hatására együttesen regulálódik. Ezek közé tartoznak az AAF/I (aggA-D) gének, a dispersin (aap), a dispersin translocator (aatPABCD). Az EHEC törzsek egyéb jellemző génjei nincsenek jelen a C227-11 genomban. Ennek alapján ez a szerző csoport is EAEC törzsnek klasszifikálta a kórokozót.

 

A német járványból izolált EAEC törzs további virulencia faktorai közösek az EAEC törzsek, valamint egyéb diarrheagen coli és shigella törzsek virulencia faktoraival. Ezek a SPATE-k. A C227-11 genom által kódolt SPATE kombináció a SepA (pAA plazmidon kódolt mucosa atrófiát és szöveti gyulladást okozó, a Shigella flexneri-ben leírt extracellularis protein), SigA (IgA proteáz szerű homológ, S. flexneri 2A-ban került felismerésre) és a Pic. Ez a kombináció igen ritka az EAEC törzsekben, de három, a szerzők által tanulmányozott afrikai törzsben, valamint az 55989-ben is megtalálható. Az EAEC törzsekben szokatlan két SPATE-nél több fehérje egyidejű jelenléte. Úgy gondolják, hogy a SPATE szám és a kombinációjuk olyan tényezők, amelyek fokozták a járványt okozó törzs virulenciáját. További potenciális virulencia faktorok a németországi járványt okozó törzsben a hosszú poláris fimbriák (long polar fimbriae LPF) és az IrgA homologue adhesion molekula (iha), amelyeket korábban EHEC, illetve más coli pathotípusokban azonosítottak. A C227-11 genomban 58, 100 bp-nál hosszabb régiót találtak, amelyek nem voltak jelen más vizsgált EAEC genomban. Ez az 58 régió összesen 180 088 bp hossszú, a genom 3,4%-a, ebből 120 000 bp a két lambda szerű fág területén található (61 022 bp és 59 914 bp). A maradék 60 000 bp ismeretlen funkciójú génekhez tartozik, de jelen van kommenzális E. coli tözsekben is, valószínűleg nem virulencia tényezők. A korábbi EAEC genomokhoz képest a németországi törzsben jelenlévő új DNS szekvenciák kis mennyisége azt az elképzelést támasztja alá, hogy a jelenlegi törzs feltehetőleg a közelmúltban alakulhatott ki.

A szerzők úgy vélik, hogy az stx2 gén és néhány szokatlan SPATE akvirációja vezetett a C227-11 törzs járványban észlelt fokozott virulenciájához.

A német törzsben található 3 plazmid közül a legnagyobb és a legkisebb nem kódol virulencia géneket. A legnagyobb, a pESBL C227-11 kiterjedt spektrumú béta lactamázt, CTX-M-15-t kódol, és nagyon hasonló a pEC Bactec plazmidhoz, amit klinikai E coli izolátumban találtak. Ezt a plazidot a legtöbb O104:H4 izolátum nem tartalmazta.

A közbülső méretű plazmid a pAA C227-11, 75 000 bp méretű, és hasonlít az EAEC izolátumok pAA plazmidjára. A szekvencia vizsgálatból kiderült, hogy ez a plazmid család jelentős diverzitást mutat. Az eredeti EAEC 042 törzs plazmidjához képest 34 000 bp a hasonló szekvencia. Az 55989 virulencia plazmidjával a szekvencia azonosság 28 000 bp. A szekvencia heterogenitás a plazmidokat illetően sokkal nagyobb, mint a kromoszomák esetében. A pAA C227-11 plazmid több EAEC specifikus virulancia faktort kódol, így az aggR, aatP A-D, aap, aggA-D és sepA géneket. Ezek a gének is lényegesek a C227-11 pathogenicitása szempontjából.

A németországi járvány előidézéséért felelős törzs példázza a génakvizíció, a laterális génátvitel drámai hatását, amelynek révén szinergista virulencia faktorok kerültek át a törzsbe. Molekuláris definíció alapján a kórokozó EAEC törzs, amely Shiga-toxint kódoló bakteriofágot vett fel, ami a STEC (EHEC) törzsek sajátossága. A szerzők hangsúlyozzák, hogy a németországi járványért felelős EAEC törzs létrejöttének alapvető momentuma, hogy a törzs őse evoluciója során Stx-kódoló profágot és ESBL-t kódoló plazmidot vett fel.

A jelenlegi törzs nem az első EAEC izolátum (francia O111 stx termelő EAEC járvány), amely Shiga-toxint kódoló fágot akvirált, viszont nyilvánvalóan az első, ami ilyen jelentős járványt okozott. A hibrid törzs pathogenicitási jellemzői alapján felvetődött az új pathotípus elnevezésére az enteroaggregative-haemorrhagic Escherichia coli (EAHEC) név is. Az elnevezés a köztudatba eddig nem ment át.

A németországi törzs különbözik a korábbi („hagyományos”) EAEC törzsektől a SPATE proteázok számának és fajtáinak tekintetében.  A legtöbb hasmenést okozó E coli törzs egy SPATE-t, a legtöbb EAEC törzs pedig általában két SPATE-t kódol. A három SPATE egyidejű jelenléte szokatlan. A Pic jelenléte általános az EAEC törzsekben, mucin hasítása révén elősegíti az intestinális colonizációt, és a leukocyta funkciót is gátolja a sejtfelszini mucinszerű glikoproteineket hasítása következtében. A németországi törzs SigA-t is termel. A protein hasítja a citoszkeletális spectrint, ami az enterociták lekerekedését és leválását idézi elő. A harmadik SPATE, a SepA virulencia funkciója jelenleg nem ismert. A szerzők úgy gondolják, hogy a három SPATE és a többi virulencia tényező együttes hatása okozhatta a Shiga toxin fokozott keringésbe jutását és a HUS igen magas előfordulási arányát a németországi járvány során.

Alexander Mellmann és mtsai, a Münsteri Egyetem Közegészségtani Intézetének munkatársai a J PLOS ONE hasábjain 2011. július 20-án (www.plosone.org) közzétették 4, (Mellmann A, Harmsen D, Cummings DA, Zentz EB, Leopold SR, Rico A, Prior K,  Szczepanowski R, Ji Y, Zhang W, McLaughlin SF, Henkhaus JK, Leopold B, Bielaszewska M, Prager R, Brzoska PM, Moore RL, Guenther S, Rothberg JM, Karch H. Prospective Genomic Characterization of the German Enterohemorrhagic Escherichia coli O104:H4 Outbreak by Rapid Next Generation Sequencing Technology.PLoS ONE 2011, 6 (7): e22751. doi:10.1371/journal.pone.0022751.) a németországi járványból származó törzs, az LB226692, az LB226543, az LB226755, az LB226806, valamint a történelmi HUSEC041 (01-09591) törzs teljes genom szekvencia analízisét, és elképzelésüket a törzs eredetéről.  Az LB226692 törzs szekvencia analízisét ion torrent PGM szekvenáló berendezéssel 62 óra alatt, a BGI intézettel azonos napon, június 2-án fejezték be. EAEC és EHEC törzsek teljes genom szekvencia analízisén alapuló filogenetikai vizsgálatuk szerint az EAEC 55989 törzs a rokonság ellenére az EHEC törzseknek mégsem olyan közeli rokona. A 2001-es HUS-t okozó O104:H4 törzs pedig fimbriális génjét és plazmidjait tekintve szintén különbözik a jelenlegi kitörést okozó O104:H4 törzstől. A szerzők elképzelése szerint az EAEC 55989, a történelmi HUSEC O41, illetve a jelenlegi O104:H4 törzs egy közös EHEC O104:H4 progenitorból eredt, ami lépésenként szerzett pathogenicitást biztosító géneket, illetve vesztett el kromoszomális és plazmidon kódolt virulencia faktorokat.

A szerzők felvetettek két lehetséges evolúciós modellt a jelenlegi járványt okozó stx pozitív EAEC genetikus hátterű O104:H4 törzs kialakulására. Az egyik lehetséges modell a közös O104:H4 progenitor törzs feltételezése, amelyből  mind a jelenlegi járványt okozó törzs, mind a történelmi HUSEC O41, mind az EAEC 55989 származik. A másik lehetőség a linearis közös törzs modell, amely szerint, a jelenlegi járványt okozó O104:H4 törzs  az EAEC 55989 prototípus törzsből jött létre. Mellmann és mtsai a történelmi 01-09591 törzs analízisének a beiktatásával úgy gondolják, hogy az ún. közös ős modell jobban megfelel a valóságnak. Egyrészt a gének és genomszigetek elvesztése gyakrabban előforduló esemény. Másrészt az stx gén inzercióját a wrbA (NADPH:quinone oxydoreductase, typeIV NQO) területére már korábban megfigyelték egyes stx termelő EAEC törzsekben. Mellmann és mtsai szerint, az előző szerzőkkel ellentétben, az EAEC 55989 E. coli O104:H4, ST678 törzs újonnan alakulhatott ki egy stx termelő E coli O104:H4 progenitor törzsből. Az O104:H4 törzs 1144 alap génje közül mindössze 24 mutat szekvenciális különbséget az 55989 törzshöz viszonyítva. Jelen van mindkét törzsben az iha gén is. A szomszédos tellurit rezisztencia gén azonban már nincs jelen az EAEC 55989-s törzsben. Ez a közös progenitorban meglévő gén az EAEC 55989-ben egy rövid időszak alatt elveszhetett. Leírták szinte valamennyi EHEC szerotípusban az stx2 gén rövid idő alatt történő elvesztését is. A HUSECO41 87, az LB226692 pedig 95 egyedi alapgenom allélt tartalmaz a modellben feltételezett progenitorhoz képest. A 2001-s 01-09591-s törzs kialakulása egy, az LB226692 kialakulása három, az EAEC 55989 kialakulása pedig hat inzerciós eseményt tételez fel a közös ős modellben. A lineáris modell szerint az EAEC 55989 (afrikai törzs) először a 01-09591 történelmi német törzs kialakulásához vezetett, majd később az utóbbi, történelmi német törzs a jelenlegi járványt okozó LB 226692 törzs létrejöttéhez. Ebben a modellben a 01-09591 létrejöttéhez az EAEC 55989 hat régiót vesztett és egy új genom régiót szerzett, majd ezt követően a törzs az LB226692 kialakulásakor ezt az újonnan szerzett régiót elvesztette, valamint három új régiót akvirált. Mindkét modellben a genom változások száma azonos, a lineáris modell azonban az új génrégió megszerzésével, majd későbbi elvesztésével a helyzetet bonyolultabban magyarázza. A 2001-es HUSECO41 megtartotta a progenitor AAF/III fimbriákat kódoló 75 kD-s plasmidját, amely szintén jelen van az EAEC 55989 törzsben. E mellett a HUSECO41 akvirált még egy 95 kb méretű, IV-es típusú pílus rendszert és TEM 1-t kódoló plazmidot. Ezzel összehasonlítva a jelenlegi járványt okozó LB226692 törzs két új plazmiddal rendelkezik, a 83 kb méretű kódolja a AAF/I fimbriákat, a másik pedig, a 90 kb méretű, a TEM 1 és a CTX M15 béta lactamázokat. A törzs elvesztette az AAF/III fimbriákat kódoló plazmidot. A nagyfokú savi rezisztencia közös a HUSECO41 és a jelenlegi törzsekben, amely tulajdonság fokozza a törzsek pathogenicitását. Fontos szerepet tulajdonítanak a vasfelvételi rendszer génjeinek is a pathomechanimusban.

Nincs biztos magyarázat arra, hogy hogyan került a betegek szervezetébe ilyen mértékben a Shiga toxin. Lehetőségként az AAF/I fimbriák jelenlétét, illetve egy ismeretlen toxin deliberaciós mechanizmust tételeznek fel.

A két munkacsoport elképzelése a németországi járványt okozó törzs eredetéről különböző. Önmagában a jelenleg rendelkezésre álló genom szekvencia adatok nem elégségesek egyik modell teljes tudományos bizonyosággal történő alátámasztására sem.

Az ehhez hasonló molekuláris elemzések népegészségügyi jelentősége a járványok során a jövőben rendkívüli fontosságú lehet.

Irodalom

A járványról megjelent öt közlemény klinikai, mikrobiológiai és genetikai adatainak összefoglalása és összehasonlítása (Bielaszewska és mtsai, The Lancet 2011, www.thelancet.com/infection. Published online  June 23, 2011 DOI:10.1016/S1473-3099 (11) 70165-7, Frank és mtsai, NEJM 2011. 10.1056/nejmoa1106483 nejm.org., Rohde  és mtsai NEJM 2011. 10.1056/nejmoa1107643 nejm.org., Rasko és mtsai  NEJM 2011. 10.1056/nejmoa1106920 nejm.org., Mellmann és mtsai, PLoS ONE 2011, 6(7): e22751. doi:10.1371/journal.pone.0022751).

Adatbázis források

Az egyes E. coli törzsekkel, génjeikkel és fehérjéivel kapcsolatos információk a következő adatbázisokból származnak.

National Center for Biotechnology Information, E. coli adatok   www.ncbi.nlm.nih.gov

Broad Institute E. coli adatbázis www.broadinstitute.org

Genecards (www.genecards.org)

Uniprot (www.uniprot.org)

KEGG (www.genome.jp/kegg/pathway.html)

EcoliWiki (ecoliwiki.net)

WikiGenes(www.wikigenes.org

Multi Locus Sequence Typing http://mlst.ucc.ie/mlst/dbs/Ecoli/.a

eBuRST (based upon related sequence types version 3 http://eburst.mlst.net/)

Clonal Frame (version 1.1) http://www.xavierdidelot.xtreemhost.com/clonalframe.htm)

Ahmed R, Bopp C, Borczyk A, Kasatiya S. Phage-typing scheme for Escherichia coli O157:H7. J Inf Dis 155, 4, 806-809, 1987.

Alba BA, Gross CA.Regulation of the Escherichia coli  sigma E–dependent envelope stress responseMolecular Microbiology 52,  613–619, 2004.

Ashkar AA, Mossman KL, Coombes BK, Gyles CL, Mackenzie R. FimH adhesin of type 1 fimbriae is a potent inducer of innate antimicrobial responses which requires TLR4 and type 1 interferon signalling. PLOS Pathogens 4, 15, 1-11, 2008.

Bae WK, Lee YK, Cho MS, Ma SK, Kim SW, Kim NH, Choi KC. A case of hemolytic uremic syndrome caused by Escherichia coli O104:H4. Yonsei Med J 47,437-439, 2006.

Beutin  L, Geier D, Steinruck H, Zimmermann S, Scheutz F. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J Clin Microbiol  31, 2483–2488, 1993.

Beutler B. Nobel Lecture by Bruce A. Beutler, 2011 www.nobelprize.org

Bielaszewska M, Tarr PI, Karch H, Zhang W, Mathys W.Phenotypic and molecular analysis of tellurite resistance among enterohemorrhagic Escherichia coli O157:H7 and sorbitol-fermenting O157:NM clinical isolates. J Clin Microbiol 43,452–454, 2005.

Bielaszewska M, Köck R, Friedrich AW, von Eiff C, Zimmerhackl LB, Karch H, Mellmann A. Shiga toxin-mediated hemolytic uremic syndrome: time to change the diagnostic paradigm? PLoS ONE 2 (10), e1024, 2007.

Bielaszewska M, Mellmann A, Zhang W, Köck R, Fruth A, Bauwens A, Peters G, Karch H. Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study.The Lancet www.thelancet.com/infection Published online June 23, 2011 DOI:10.1016/S1473-3099 (11) 70165-7, 2011.

Bitter W, Houben ENG, Bottai D, Brodin P, Brown EJ, Cox JS, Derbyshire K, Fortune SM, Gao L-Y, LiuJ, Gey van Pittius NC , Pym AS, Rubin EJ, Sherman DN, Cole ST, Brosch R.Systematic Genetic Nomenclature for Type VII Secretion Systems. PLOS Pathogens 5, 1-6,2009.

Bitter W. Type VII secretionand the mycobacterial cell envelope Microbiology Today May, 102-106, 2011.

Blattner FR, Plunkett G, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA,. Goeden MA, Rose DJ, Mau B, Shao Y. The complete genome sequence of Escherichia coli K-12. Science 5, 1453-1462, 1997.

Brigotti M, Carnicelli D, Accorsi P, Rizzi S, Montanaro L, Sperti S. 4-Aminopyrazolo[3,4-d]pyrimidine (4-APP) as a novel inhibitor of the RNA and DNA depurination induced by Shiga toxin 1. Nucleic Acids Res 2383-2388, 2000.

Carniel E. The Yersinia high-pathogenicity island: an iron-uptake island. Microbes and Infection, 3, 561−569, 2001.

Clarke MB, Sperandio V. Events at the host-microbial interface of the gastrointestinal tract III. Cell-to-cell signaling among microbial flora, host, and pathogens: there is a whole lot of talking going on. Am J Physiol Gastrointest Liver Physiol 288, G1105–G1109, 2005.

Conradi H. Über losliche, durch asptische Autolyse erhaltene giftstoffe von Ruhr- und Typhus-Bazillen. Dtsch Med Wochenschr 29, 26-28, 1903.

Crosa JH, Mey AR, Payne SM. eds. Iron transport in bacteria. ASM Press, American Society of Microbiology, Washington DC, USA, 2004

Crowley DE, Wang YC, Reid CPP, Szaniszlo PJ. Mechanisms of iron acquisition from siderophores by microorganisms and plants.Plant and Soil,130, 179-198,1991.

Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity, Nat Rev Microbiol 8, 26-38, 2010.

Deane JE, Roversi P, Cordes FS, Johnson S, Kenjale R, Daniell S, Booy F, Picking WD, Picking WL, Blocker AJ. Lea SM. Molecular model of a type III secretion system needle: Implications for host-cell sensing. PNAS 103,12529–12533, 2006.

ECDC Directors’presentation. Understanding the 2011EHEC/STEC outbreak in Germany. ICAAC Conference, 17 September 2011, Chicago, USA

EFSA/ECDC JOINT RAPID RISK ASSESSMENT. Cluster of haemolytic uremic syndrome (HUS) in Bordeaux, France, 29 June 2011. Updated from 24 June.

ECDC Rapid Risk Assesment Outbreak of Shiga toxin producing E. coli ( STEC) in Germany. Update 14, June 2011.

ECDCRAPID RISK ASSESSMENT UPDATE.Outbreak of Shiga toxin-producing E. coli (STEC) O104:H4 2011 in the EU 8 July 2011. Updated from 29 June.

EFSA/ECDC JOINT RAPID RISK ASSESSMENT. Cluster of haemolytic uremic syndrome (HUS) in Bordeaux, France, 29 June 2011. Updated from 24 June.

Eidels IL, Proia RL, Hart DA. Membrane receptors for bacterial toxins Microbiol Rev 47, 596-620, 1983.

Elsinghorst EA, Kopecko DJ. Molecular Cloning of Epithelial Cell Invasion Determinants from Enterotoxigenic Escherichia coli. Infect Immun 60, 2409-2417, 1992.

Enter-net Quarterly VTEC Report 2007/1 January-March 2007.

Enter-net Quarterly VTEC Report 2007/2 April-July 2007.

Farfan MJ, Inman KG, Nataro JP. The major pilin subunit of the AAF/II fimbriae from enteroaggregative Escherichia coli mediates binding to extracellular matrix proteins. Infect Immun 76, 4378–4384, 2008.

Filloux A, Hachani A, Bleves S. The bacterial type VI secretion machine: yet another player for protein transport across membranes.  Microbiology 154, 1570–1583, 2008.

FoodNet Population Survey, 2006-2007.

Frank C, Werber D, Cramer JP, Askar M, Faber M, an der Heiden M, Bernard H, Fruth A, Prager R, Spode A, Wadl M, Zoufaly A, Jordan S, Stark K, Krause G for the HUS Investigation Team. Epidemic profile of Shiga-toxin–producing Escherichia coli O104:H4 outbreak in Germany — preliminary report  NEJM 2011. 10.1056/nejmoa1106483 nejm.org.

Frank KM, Schneewind O, Shieh W-J. Investigation of a Researcher’s Death Due to Septicemic Plague.  NEJM 364, 26, 2563-2564, 2011.

10.1056/NEJMc1100859, updated on June 30, 2011, at NEJM.org

Gasser C, Gautier E, Steck A, Siebenmann R E, Oechslin R. Hӓmolytisch-uramische Syndrome: bilaterale Nierenrindennekrosen bei akuten erworbenen hӓmolytischen Anamien. Schweiz med Wschr 85, 905-909, 1955.

Gerner-Smidt P, Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, Barrett TJ. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of  Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathogens and Disease. Spring 3(1): 59-67, 2006.

Grover V, Ghosh S, Chakraborti A, Majumdar S, Ganguly NK. Galactose-specific fimbrial adhesin of enteroaggregative Escherichia coli: a possible aggregative factor. Current Microbiol 54, 175–179, 2007.

Henderson IR, Navarro-Garcia F, l Desvaux M, Fernandez RC, Ala’Aldeen D.  Type V Protein Secretion Pathway: the autotransporter story Microbiol Mol Biol Rev 68, 692–744, 2004.

Hofmann N, Wurm R, Wagner R. The E. coli anti-sigma factor rsd: Studies on the Sspecificity and regulation of its expression. PLoS ONE 6 (5), e19235, 2011.

Huang BD Mohanty A, DuPont HL, Okhuysen PC, Chiang T. A review of an emerging enteric pathogen: enteroaggregative Escherichia coli. J Med Microbiol 55, 1303-1311, 2006.

Hussein HS. Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J Animal Sci 85, E63-72, 2007.

Johnson W M, Lior H, Bezanson GS. Cytotoxic Escherichia coli O157:H7 associated with haemorrhagic colitis in Canada. Lancet i:76, 1983.

KarmaliM, SteeleBt, PetricM, LimC.Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet i: 619-620, 1983.

Kausar Y, Chunchanur SK, Nadagir SD, Halesh LH, Chandrasekhar MR.Virulence factors, Serotypes and Antimicrobial Suspectibility Pattern of Escherichia coli in Urinary Tract Infections. Al- Ameen J Med Sci 2, 47 -51, 2009.

Keusch GT, Grady GF, Takeuchi A, Sprinz H. The pathogenesis of Shigella diarrhoea. II. Enterotoxin induced acute enteritis in the rabbit ileum. J Infect Dis 126, 92–95, 1972.

Konowalchuk J, Speirs JI, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immun 18, 775–779, 1977.

Lord JM, Roberts LM. Retrograde transport: Going against the flow. Current Biology8: R56–R58, 1998.

Mellmann A, Harmsen D, Cummings DA, Zentz EB, Leopold SR, Rico A, Prior K,  Szczepanowski R, Ji Y, Zhang W, McLaughlin SF, Henkhaus JK, Leopold B, Bielaszewska M, Prager R, Brzoska PM, Moore RL, Guenther S, Rothberg JM, Karch H. Prospective genomic characterization of the German enterohemorrhagic Escherichia coli O104:H4 outbreak by rapid next generation sequencing technology.PLoS ONE 2011, 6 (7): e22751. doi:10.1371/journal.pone.0022751.

Michino H, Araki K, Minami S, Takaya S, Sakai N, Miyazaki N, Ono A, Yanagawa H. Massive Outbreak of Escherichia coli O157:H7 Infection in schoolchildren in Sakai City, Japan, associated with consumption of white radish sprouts. Amer J Epidemiol 150, 787-796, 1999.

Morabito S, Karch H, Mariani-Kurkdjian P, Schmidt H, Minelli F, Bingen E, Caprioli A. Enteroaggregative, Shiga Toxin-Producing Escherichia coli O111:H2 Associated with an Outbreak of Hemolytic-Uremic  Syndrome.  J Clin Microbiol 36,840-842, 1998.

Mossoro C, Glaziou P, Yassibanda S, Lan NTP, Bekondi C, Minssart P, Bernier C, Le Bouguenec C, Germani Y. Chronic diarrhea, hemorrhagic colitis, and hemolytic-uremic syndrome associated with HEp-2 adherent Escherichia coli in adults infected with human immunodeficiency virus in Bangui, Central AfricanAfrican Republic. J Clin Microbiol 40, 3086-3088, 2002.

Nataro JP, Kasper JB. Diarrhaegenic Escherichia coli. Clin. Microbiol. Rev. 11, 142-201, 1998.

Neilands JB, Siderophores: Structure and function of microbial iron transport compounds J Biol Chem, 270, 45, 26723-26726, 1995.

Neisser A, Shiga K. Über freie Rezeptoren von Typhus- und Dysenterie Bazillen und über das Dysenterie Toxin. Dtsch Med Wochenschr 29, 61-62, 1903.

Novicki B, Moulds J, Hull R, Hull S.A hemagglutinin of uropathogenic Escherichia coli recognizes the Dr blood group antigen. Immun Infect 56, 1057-1060, 1988.

O’Brien AD, LaVeck GD, Griffin DE, Thompson MR. Characterization of Shigella dysenteriae 1 (Shiga) toxin purified by anti-Shiga toxin affinity chromatography. Infect Immun 30, 170–179, 1980.

O’Brien  AD, Lively TA, Chen ME, Rothman SV, Formal SB. Escherichia coli O157:H7 strains associated with haemorrhagic colitis in the United States produce a Shigella dysenteriae 1 (Shiga) like cytotoxin. Lancet i:702, 1983.

Okeke I.N., Wallace-Gadsden F., Simons R., Matthews N., Labar A.S., Hwang J., Wain J. Multi-locus sequence typing of enteroaggregativ Escherichia coli isolates from Nigerian children uncovers multiple lineages. J Plos One 5, 1-12, 2010.

Országos Epidemiológiai Központ. Shigatoxin termelő E. coli (STEC) által okozott járvány Németországban. EPINFO 18, (20. szám), 209-214, 2011 (május 27). 

Perna NT, Mayhew GF, Posfai Gy, Elliott S, Donnenberg MS, Kaper JB, Blattner FR.  Molecular evolution of a pathogenicity island from Eenterohemorrhagic Escherichia coli O157:H7. Infect Immun 66, 3810–3817, 1998.

Post KW, Bosworth BT, Knoth JL. Frequency of virulence factors in Escherichia coli isolated from pigs with postweaning diarrhoe and edema disease in North Carolina. Swine Health and Production 8, 119-120, 2000.

Prager R, Strutz U, Fruth A, Tschäpe H. Subtyping of pathogenic Escherichia coli strains using flagellar (H)-antigens: serotyping versus fliC polymorphisms. Int J Med Microbiol 292, 477-486, 2003.

Price NL, Raivio TL. Characterization of the Cpx Regulon in Escherichia coli Strain MC4100. J Bacteriol 191,1798-1815, 2009.

Proulx F, Seidman EG, Karpman D. Pathogenesis of Shiga toxin–associated hemolytic uremic syndrome.Pediatr Res 50, 163–171,2001.

Qadri F, Svennerholm A-M, Faruque ASQ, Sack RB. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin Microbiol Rev 18,465–483, 2005.

Rasko DA, Webster DR, Sahl JW, Bashir A, Boisen N, Scheutz F, Paxinos EE, Sebra R, Chin C-S, Iliopoulos D, Klammer A, Peluso P, Lee L, Kislyuk AO, Bullard J, Kasarskis A, Wang S, Eid J, Rank D, Redman JC, Steyert SR, Frimodt-Møller J, Struve C, Petersen AM,  Krogfelt KA, Nataro JP, Schadt EE, Waldor MK. Origins of the E. coli strain causing an outbreak of hemolytic–uremic syndrome in Germany.  NEJM 2011. 10.1056/nejmoa1106920 nejm.org.

Richard H, Foster JW. Escherichia coli glutamate- and arginine-dependent acid resistance systems increase internal pH and reverse transmembrane potential.  J Bacteriol. 186, 6032–6041, 2004.

Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, Hebert RJ, Olcott ES, Johnson LM, Hargrett NT, Blake PA, Cohen ML.Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med 308:681–685, 1983.

Rohde H, Qin J, Cui Y, Li D, Loman NJ, Hentschke M, Chen W, Pu F, Peng Y, Li J, Xi F, Li S, Li Y, Zhang Z, Yang X, Zhao M, Wang P, Guan Y, Cen Z, Zhao X, Christner M, Kobbe R, Loos S, Oh J, Yang L, Danchin A, Gao GF, Song Y, Li Y,Yang H, Wang J, Xu J, Pallen MJ, Wang J, Aepfelbacher M, Yang R and the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium. Open-source genomic analysis of Shiga-toxin–producing E. coli O104:H4.  NEJM 2011. 10.1056/nejmoa1107643 nejm.org,

Sandvig K, van Deurs B. Entry of ricin and Shiga toxin into cells. Molecular mechanisms and medical perspectives. EMBO J 19, 5943-5950, 2000.

Sandvig K, van Deurs B. Transport of protein toxins into cells: pathways used by ricin, cholera toxin and Shiga toxin. FEBBS Lett 529, 49-53, 2002.

Servin AL. Pathogenesis of Afa/Dr diffusely adhering Escherichia coli. Clin  Microbiol Rev 18, 264–292, 2005.

Shiga K. Über den Dysenterie-Bazillus (Bacillus dysenteriae). Zentralbl Bakteriol Orig 24, 913-918, 1898.

Stork M, Di Lorenzo M, Mourin S, Osorio CR, Lemos ML Crosa JH. Two tonB systems function in iron transport in Vibrio anguillarum, but only one is essential for virulence.  Infect Immun 72, 7326–7329, 2004.

Tarr PI, Gordon CA, Chandler WL.Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 2005; 365: 1073–86.

Tseng T-T, Tyler BM, Setubal JC. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BioMed Central Microbiology 9 (Suppl 1): S2, 2009.

VFDB: Virulence factors of bacterial pathogens, www.mgc.ac.cn/VFs/main.htm.

Walther-Rasmussen J, Høiby N. Class A carbapenemases. J Antimicrobial Chemotherapy 60, 470–482, 2007.

Wassmer T, Attar N, Harterink M, van Weering JRT, Traer CJ, Oakley J, Goud B, Stephens DJ, Varkade P, Korswagen H, Cullen PJ. The retromer coat complex coordinates endosomal sorting and dynein-mediated transport, with carrier recognition by the trans-Golgi network. Developmental Cell 17, 110–122, 2009.

Welch RA, Burland V, Plunkett G, Redford P, Roesch P, Rasko D, Buckles EL, Liou S-R, Boutin A, Hackett J, Stroud D, Mayhew GF, Rose DJ, Zhou S, Schwartz DC, Perna NT, Mobley HLT, Donnenberg MS, Blattner FR. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli.  PNAS99, 17020–17024, 2002.

Xu J-G, Cheng B, Wen X, Cui S, Ye C. High-Pathogenicity island of Yersinia spp. in Escherichia coli strains isolated from diarrhea patients in China. J Clin Microbiol 38, 4672–4675, 2000.